Grantee Research Project Results

Final Report: Environmental Research and Technology Transfer Program of The Consortium for Plant Biotechnology Research, Inc.

EPA Grant Number: EM834388
Center: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program
Center Director: Schumacher, Dorin
Title: Environmental Research and Technology Transfer Program of The Consortium for Plant Biotechnology Research, Inc.
Investigators: Schumacher, Dorin , Cheng, Zong-Ming , Kessler, Michael , Larock, Richard C. , Paterson, Andrew , Pullman, Gerald , May, Sheldon
Institution: The Consortium for Plant Biotechnology Research, Inc
EPA Project Officer: Packard, Benjamin H
Project Period: January 1, 2009 through December 31, 2012 (Extended to December 31, 2013)
Project Amount: $1,706,000
RFA: Targeted Research Center (2009) RFA Text |  Recipients Lists
Research Category: Targeted Research , Consortium for Plant Biotechnology

Objective:

Project 1: Characterization of the poplar XTH22 gene that is consistently up-regulated by four major environmental stresses

• Objective 1: To characterize the transgenic plants for enhanced tolerance to high and low temperature, drought and flooding.
• Objective 2: To determine whether the PtXTH22 promoter can be used as a broad stress-inducible promoter.
• Objective 3: To characterize the promoter of the PtXTH22 gene.  

Project 2: Fiberglass reinforced polymers from agricultural oils

The goal of this project was to develop bio-based resins, prepared by co-polymerization of  agricultural oils (e.g. corn, linseed, and soybean) and derivatives, with commercially available co-monomers, for the manufacture of fiberglass reinforced composites used in pultrusion processing.  Pultrusion is a continuous manufacturing process for creating composites with a constant cross-section.  In the pultrusion process (shown schematically in Figure 1 below), the fiber reinforcement is impregnated with the resin matrix and pulled through a heated die where it is shaped and cured in one continuous step.  

Fig 1. Schematic of the pultrusion process. Image adopted from Sumerak, J. E., Pultrusion, in ASM Handbook-Composites, ASM International, Vol. 21, Materials Park, OH, 2001.

The specific objectives for the project were the following:

1. develop appropriate resin formulations with the right combination of processing viscosity, cure kinetics, and ultimate thermo-mechanical properties for pultrusion processing.
2. determine the best processing conditions for the pultruded fiberglass/bio-resin systems in order to maximize the thermo-mechanical properties of the composites and economics of the system, and
3. evaluate the long term strength and durability of the composites compared to existing polyester materials through accelerated aging and environmental exposure testing.

Project 3: Sequencing the genome of cotton

 

1. Paired-end sequencing of about 120,000 BACs, roughly equally sampling the two libraries described above, to be done by subcontract to a fee-for-service vendor selected on a competitive basis.  
2. Computational analysis of the resulting sequence assembly by several tests to identify possible errors, conducted in the PI’s lab as described (Paterson et al., 2009), including:

• Comparison to the order of sequence-tagged-sites along the (~1 cM density) cotton genetic map (Rong et al., 2004), to investigate accuracy across regions of several cM or more;
• Comparison to the order of overgo and BAC-end sequences in BAC clones comprising the physical map (detailed above), testing contiguity of regions of less than the ~1 cM resolution of the genetic map, down to the ~100 kb average size of a BAC;
• Comparison to the Arabidopsis genome, the most complete angiosperm genome and the closest relative of cotton that has been fully sequenced.  We have previously shown appreciable microsynteny and even some regions of macrosynteny between Arabidopsis and cotton (Rong et al., 2005a). A sequence scaffold would not be expected to show long stretches of cotton-Arabidopsis synteny if incorrectly assembled. However, since there will surely be many (hundreds?) small rearrangements between these taxa, synteny information will only be used to support other lines of evidence, and the assembly will never exclusively rely on synteny to support any genome arrangement.

Project 4: Redox potential controls pine embryo development in vitro

Hypothesis 1: Natural redox agents control redox potential in developing female gametophyte & embryo. Objective 1: Use LC/MS and LC/MS/MS to confirm and extend preliminary results to identify and profile ascorbic acid (reduced), dehydroascorbate (oxidized), glutathione (reduced) and glutathione disulfide (oxidized) in female gametophyte and embryo tissues.  

Hypothesis 2: Redox potential controls somatic embryo development in vitro.

• Objective 2: Run early-stage, maturation, and germination somatic embryo growth tests with natural redox chemicals
• Objective 3: Run early-stage, maturation, and germination somatic embryo growth tests with alternative redox chemicals.
• Objective 4: Measure ascorbic acid (reduced), dehydroascorbate (oxidized), glutathione (reduced) and glutathione disulfide (oxidized) in somatic embryos to determine if target concentrations found in zygotic embryos are achieved during growth in vitro.

Hypothesis 3:  Medium redox potential changes over time due to air exposure, tissue growth and medium components.

• Objective 5: Determine medium redox potential change over time due to air exposure and tissue growth. Objective 6: Develop methods to control medium redox potential to desired levels over time and in presence of growing somatic embryos.   

Summary/Accomplishments (Outputs/Outcomes):

Project 1: Characterization of the poplar XTH22 gene that is consistently up-regulated by four major environmental stresses

The work in the first year has been focused on the Objective 1: to characterize the transgenic plants for enhanced tolerance to high and low temperature, drought and flooding. We have transferred transgenic aspen plants with CaMV35-PtXTH22 in pots, tested for drought tolerance. The plants were fully watered and then were left without watering for 7 days. The figure 1 showed that the transgenic plants showed signs of resistance to drought. 

Fig. 1. Drought tolerance test. Upper row: transgenic line 18 showing  growing quite normally,  lower row: control plants wilting

Since mannitol is an osmotic regulator, we also tested the transgenic plants with high concentration mannitol. The transgenic plants showed resistance to 350 mM, while control plants showed heavy stress under the same concentration (Figure 2).

 

Figure 2. Mannitol  stress tolerance of transgenic poplar plants  with over-expressed  PtXTH22 gene. 

Due to the high resistance to stress hormone ABA, and the earlier results in maize suggested that there is change in chloroplast ultrastructures. We carried out electron microscopy of transgenic aspen plants and the control, as well as stress treated transgenic plants, to determine how the overexpressed PyXTH22 gene affects chloroplast ultrastructures. Not only has phenotype of transgenic aspen over- or under expressed PtXTH22 changed under ABA treatment, but also chloroplast ultrastructure difference has been found between transgenic plant leaves and non-transgenic control. Fig.3 showed chloroplasts from overexpressed transgenic aspen leaves (Fig.3E) had a greater number of thylakoids per granum compared to chloroplasts from control leaves (Fig. 3A) and RNAi transgenic aspen leaves (Fig. 3C). Under 20 mM ABA treatment, chloroplasts from over-expressed transgenic aspen leaves (Fig. 3F) had fewer number of thylakoids per granum, in contrast to chloroplasts from control leaves (Fig. 3B) and RNAi transgenic aspen leaves (Fig. 3D). 

Fig. 3 Transmission electron microscopy (TEM)  showing the difference of chloroplast ultrastructure between transgenic plant leaves and wild type control, with or without ABA treatment.

Since there is no report on plant XTH genes respond to ABA till now, it is not clear what happened between ABA signal and XTH gene expression. We tested several genes expression profile in ABA signal transduction passway, ABA responsive elements and ABA regulators. But no significant differential expression has been found in these genes, ABI1C, ABI3, Bzip28, ERD1 and CBF1, under ABA treatment. In order to further investigate the ‘black box’ between ABA signal and XTH genes responding, we have transformed PtXTH22 gene to Arabidopsis and got T2 seeds for functional characterization. ABA and mannitol treatment in transgenic Arabidopsis are underway.  

Due to its strong ABA and drought tolerance in transgenic aspen, we have transformed soybean plants with the CaMV35S::PtXTH22, and generated plants. Since soybean is a major crop in the USA and the world, and drought frequently threat the soybean production. We have generated 9 lines of soybean Jack with the gene and have confirmed the transformation.  

Fig. 4. Transgenic Jack soybean which has been transformed with the CaMV35S:PtXTH22 (A: small plant, B: large plant), and polymerase chain reaction to confirm transformation by the bar marker gene (C) and the drought tolerance PtXTH22 gene (D). These plants will be tested for drought tolerance in the next generation seeds.

The work in 2013 has been focused on characterization of the PtXTH22 transgenic soybean for its drought tolerance and determination of whether the PtXTH22 promoter can be used as a broad stress-inducible promoter. 

PtXTH22 transgenic soybean

Transgenic line#9 was planted in greenhouse to select its homozygote plants. Homozygote plants were got through three generations. They were subject to whole plant drought stress treatment.

Table 1  Time of transgenic soybean withering after drought treatment

	days to withering										average
ck	13	13	13	13	13.5	13	13.5	14			^13.25±0.1428
line9+(tray#1)	16.5	15	16	15	15	15	15	15.5	15	14.5	^5.25±0.3472
line9+(tray#2)	15	16.5	15	15	15	15	16.5	16	16.5	18	^15.85±1.0583

There was no difference between XTH22 Transgeic plants and control in withering days, which indicated that XTH22 gene from populous does not enhance drought tolerance for soybean.

       

XTH22                                  Control

Transgenic soybean

1. leaf dehydration treatment for XTH22 transgenic soybean

Leaves from XTH22 transgenic plants were subject to dehydration treatment.  There were no difference between control and transgenic lines, which indicated that XTH22 does not enhance drought tolerance for soybean.

Verify the expression of PtXTH22 promoter under different stress conditions by ectopic pMDC162PtXTH22 promoter-GUS expression in transgenic Arabidopsis

The 1508 bp promoter of XTH22 gene from the genome of Populus trichocarpa ‘Nisqually-1’ was cloned by the primer pair: 5’AACAACCACACAATGTT’3 (forward) and 5’AACCGTAAACAAGAAATATTAAACAAC’3 (reverse). The fragment was fused in frame with the GUS reporter gene and cloned into the pMDC 162 vector by Gateway method, and then the vector was transformed into Arabidopsis. To determine whether the PtXTH22 promoter responded to stress treatments, eight-week old transformed Arabidopsis plants were treated with 4ºC, 10 μM ABA, 250mM NaCl and 10% PEG8000 for 16 h, respectively, then assayed by histochemical staining for GUS activity. The pictures in the figure below showed four transgenic lines (A, B, C and D) as examples, which were taken before and after different stress treatments. There weren’t obvious induced expression of PtXTH22 promoter when treated with 4ºC, 10 μM ABA, 250mM NaCl and 10% PEG8000 in all of these four transgenic lines. More tests might be needed in denying the broad stress-inducible function of PtXTH22 promoter.

Project 2: Fiberglass reinforced polymers from agricultural oils

In our initial work we investigated and optimized suitable bio-based resins for the pultrusion processing method. Among the variety of bioresins that have been developed at Iowa State over the past 10 years, ROMP-based copolymer of modified linseed oil (Dilulin) and dicyclopentadiene (DCPD) was the first choice for development in pultrusion processing. Since this resin system cures very fast with Grubbs’ catalyst, and the resulting polymer has good mechanical properties, it seems to be an ideal candidate for pultrusion processing. After evaluating several compositions, the optimized composition for this bio-based resin was selected at 30 wt % Dilulin and 70 wt % DCPD (designated as Dil30DCPD70 for short). Another potential bio-based resin investigated for the pultrusion process is a copolymer of soybean oil, styrene and divinylbenzene (DVB) which is prepared from a cationic polymerization method. The optimized formulation is 50 wt % soybean oil, 25 wt % styrene and 23 wt % DVB, initiated with 2 wt % boron trifluoride (BFE). With the optimized composition, relatively good mechanical properties and suitable onset cure temperature was obtained.            

We noticed that Dilulin/DCPD bio-based resins were very tough, especially compared with commercially available thermosets, including the benchmark unsaturated polyester resins typically used in pultruded fiberglass composites. We have found that while the strength and stiffness of the bio-based Dil30DCPD70 ROMP polymers are lower than the polyester resin, the failure strain and toughness (area under the stress strain curve) are significantly higher than polyester as shown in Figure 2 below.

Fig. 2. (left) Representative stress-strain curves for bio-based resin and unsaturated polyester resin.  (right) while the strength and stiffness (Young’s modulus) is higher for the polyester resin, the ultimate strain and toughness is significantly higher for the bio-based resin.

Further studies were carried out with Dilulin/DCPD resin system and glass fiber reinforced composites. Essential work of fracture and J-integral fracture testing was carried out to study the fracture toughness and the toughening mechanism of Dilulin/DCPD bioresins. Among a series of compositions of Dilulin/DCPD resins, Dil30DCPD70 shows the highest toughness. We hypothesize that the toughness property is closely related to crosslink density for these thermosets. On one hand, with high crosslink density, more covalent bonds break on the fracture surface, absorbing more energy. On the other hand, high crosslink density usually results in lower shear yielding via network stretching and lower energy absorption in this step. So 30 wt% Dilulin and 70 wt% DCPD is the optimized composition which shows the highest toughness. The promising toughness property of Dil30DCPD70 may bring some potential applications for this bioresin, such as energy absorbing structures and impact resistance.

We also worked on improving the interfacial adhesion of glass fiber reinforced Dil30DCPD70 bio-based resin with various silane coupling agents. Previous study of this composite system showed that poor interface exists, which usually results in lower mechanical properties. Our purpose is to improve the interfacial adhesion between the glass fiber and the bio-based resin matrix. Two type of silanes were applied, norbornenylethyldimethylchlorosilane (MCS) and norbornenylethyltrichlorosilane (TCS). Interfacial adhesion was evaluated by microbond pull-out technique, which showed improvement in the interfacial shear strength (IFSS) with both silanes. IFSS increased ~150% with MCS and IFSS increased ~50% with MCS, compared with as-received glass fiber (see Figure 3 below). Dynamic mechanical analysis (DMA) studies of silane-treated fiberglass/Dil30DCPD70 laminates showed increased storage modulus and glass transition temperature with both types of composites, especially the one contains MCStreated fiber. Studies indicate that MCS works better than TCS on improving the interfacial adhesion in composites. So in the future, MCS will be applied to glass fiber in the pultrusion process to improve the mechanical properties of the pultruded composite.

Fig. 3. Interfacial shear strength (IFSS) for different type of fibers

We also evaluated the short and long term performance of Dil30DCPD70 bio-based resin under different conditions. Samples were treated in an accelerating weathering chamber at Pella Corporation with UV radiation (see Figure 4), full-spectrum sun light and severe hot-wet-cold circular weathering exposure. Tensile test results of UV-treated samples show that tensile strength and Young’s modulus didn’t change within 1000h UV treatment, and then decreased slightly with longer exposure time. But break strain and tensile toughness decreased significantly due to the formation of surface cracks under even short time exposure. Similar results also show in fullspectrum sun light exposure samples and hot-wet-cold circular exposure samples. Soxhlet extraction results indicate that crosslink density of the bioresin was enhanced a little bit after UV treatment. Photoacoustic spectroscopy and SEM both demonstrate that degradation is a surface effect. About 100µm thick degradation layer was observed on the sample exposed to the most severe condition in our experiment, 2000h UV radiation.   

Fig. 4. Change is polymer appearance after exposure to QUV accelerated weathering experiments for times ranging from 0 (left) to 1000 h (right).

We used a table-top pultrusion machine in to estimate processing conditions for fiberglass/bioresin system (shown in Figure 5). The table-top pultrusion contains roller guide, resin bath, die, heat plates and puller. The die is 600 mm long with a rectangular profile of 25mm x 2mm. During processing, the die was divided into three heating zones, two relatively low temperature heating zones on both ends and one high temperature heating zone in the middle. We have made composites using both commercial polyester and the ROMPbased bioresin (Dil30DCPD70) (see Figure 6). We have overcome one of significant problems-sticking with coating the inner surface of die with Teflon tape. Another significant problem we dealt with is increasing the pulling force of the nip roller puller through replacing a more powerful motor and designing a suitable gear train. 

Fig. 5. Bench top pultrusion system designed and built for this project for continuous manufacturing of bio-resin/fiberglass composites.

Fig. 6. Polyester and bio-resin samples made by the pultrusion process,

Project 3: Sequencing the genome of cotton

Paired-end sequencing of about 120,000 BACs – this has been completed.  Indeed, while our proposal was under consideration by CPBR, another (public) entity supported end-sequencing of about 60,000 BACs from the G.

raimondii HindIII library.  Accordingly, the PI and representatives of the matching company (Bayer) agreed to an accordingly reduced investment in BAC end sequencing (that has been met through a contract with a third party, the Hudson Alpha Institute) … redirecting the remaining resources to reduced-representation resequencing of about 30 cotton genotypes, about 14 of which are selected by Bayer for proprietary reasons.  The remainder will be selected from publicly-available germplasm by the PI but in consideration of feedback from Bayer, giving preference to genotypes from which there exist other publicly-available resources (for example Pima S6 and Acala Maxxa have BAC libraries, and G. barbadense K101 was used in reference genetic mapping), and/or which are parents of populations that are being made toward a cotton nested association mapping (NAM) resource.  The public lines have been completed, with data analysis in progress.  Bayer has shipped DNA of its lines to the PI, and their analysis is also in progress.  

Computational analysis of the resulting sequence assembly by several tests to identify possible errors, conducted in the PI’s lab as described (Paterson et al., 2009), including:

a.    Comparison to the order of sequence-tagged-sites along the (~1 cM density) cotton genetic map (Rong et al.,

2004), to investigate accuracy across regions of several cM or more;

b.    Comparison to the order of overgo and BAC-end sequences in BAC clones comprising the physical map (detailed above), testing contiguity of regions of less than the ~1 cM resolution of the genetic map, down to the ~100 kb average size of a BAC;

c.     Comparison to the Arabidopsis genome, the most complete angiosperm genome and the closest relative of cotton that has been fully sequenced.  We have previously shown appreciable microsynteny and even some regions of macrosynteny between Arabidopsis and cotton (Rong et al., 2005a). A sequence scaffold would not be expected to show long stretches of cotton-Arabidopsis synteny if incorrectly assembled. However, since there will surely be many (hundreds?) small rearrangements between these taxa, synteny information will only be used to support other lines of evidence, and the assembly will never exclusively rely on synteny to support any genome arrangement.

Items a and b, above, were completed in advance of public release (under Ft Lauderdale principles) of the genome assembly in January 2012.  

Item c was completed as an element of the primary description of the cotton reference genome sequence (Paterson et al 2012, see below), confirming early results supportive of the high quality of assembly, and revealing an unexpected dimension of cotton genome evolution, specifically that it has experienced a paleopolyploidy of complexity previously unprecedented … it remains unclear whether this resulted in an aggregate 5x or 6x increase of cotton chromosome numbers, and whether it was a single event or two very closely spaced events (for example 3x followed by 2x).  

Project 4: Redox potential controls pine embryo development in vitro

• Seed tissues were collected during summer 2011 that will allow us to begin processing tissue for objective 1.  
• Early-stage bioassay growth tests were run with natural redox chemicals including glutathione and ascorbic acid. Both caused statistically significant increases in early-stage somatic embryo growth. (objective 2)
• Early-stage bioassay growth tests were run with inorganic redox chemicals including: sodium bisulfite, sodium dithionite, sodium metabisulfite, sodium sulfite and sodium thiosulfate. All redox chemicals caused statistically significant increases in early-stage somatic embryo growth. (objective 2)
• The strongest growth stimulation was seen with sodium thiosulfate. During summer 2011 somatic embryogenesis culture initiation tests were run Pinus taeda (loblolly pine) immature seed with a control initiation medium without and with sodium thiosulfate. Statistically significant increases in embryogenic tissue initiation occurred across the five seed sources tested. (objective 2)
• Embryogenic tissue initiation tests were carried out during summer 2012 with P. taeda immature seed. Tests were run with a control medium without redox chemicals, with the addition of 1.0 mM sodium thiosulfate, and with the addition of 0.057 mM sodium dithionite. Statistically significant increases in embryogenic tissue initiation occurred for both chemicals using three generally recalcitrant seed sources. Initiation increased from 8.8% without redox chemicals to 16.7% with sodium thiosulfate and 17.3% with sodium dithionite. (objective 2)
• Embryogenic tissue initiation tests were run during summer 2012 with Pseudotsuga menziesii (Douglas fir) immature seed. The same experimental design was used for Douglas fir that was used for loblolly pine. Again, embryogenic tissue initiation was increased by redox chemicals. Using five high-value full-sibling crosses, initiation for control medium averaged 32.1%, 1.0 mM sodium thiosulfate treatments averaged 31.7% and 0.057 mM sodium dithionite treatments averaged 40.0% with statistically significant differences from the control medium for the sodium dithionite treatments. 

Conclusions:

Project 1: Characterization of the poplar XTH22 gene that is consistently up-regulated by four major environmental stresses

Project Completed.

Project 2: Fiberglass reinforced polymers from agricultural oils

Continued development of bio-based resins and composites.

Project 3: Sequencing the genome of cotton

We plan a group of 2-3 additional manuscripts based on the resulting data, written as ‘companion papers’, that will address the spectrum of genetic diversity in the Gossypium genus.

We have secured modest funding from Cotton Inc for development of genetic populations important to translating the information generated under this support to economic impact.  We are also seeking USDA-AFRI support, and have had early encouraging discussions with NSF about a followup project.  

Project 4: Redox potential controls pine embryo development in vitro

Commence proposed analytical work. Continue growth tests to determine effects of redox chemicals on early-stage growth, culture initiation, embryo development, and somatic embryo germination. 

Journal Articles: 10 Displayed | Download in RIS Format

Publications Views

Other center views:	All 32 publications	11 publications in selected types	All 10 journal articles

Publications

Type	Citation	Sub Project	Document Sources
Journal Article	Chougule NP, Li H, Liu S, Linz LB, Narva KE, Meade T, Bonning BC. Retargeting of the Bacillus thuringiensis toxin Cyt2Aa against hemipteran insect pests. Proceedings of the National Academy of Sciences of the United States of America 2013;110(21):8465-8470.	EM834388 (2012)	Full-text from PubMed Abstract from PubMed Associated PubMed link Full-text: PNAS-Full Text HTML Exit Abstract: PNAS-Abstract Exit Other: PNAS-Full Text PDF Exit
Journal Article	Cui H, Kessler MR. Glass fiber reinforced ROMP-based bio-renewable polymers: enhancement of the interface with silane coupling agents. Composites Science and Technology 2012;72(11):1264-1272.	EM834388 (2012) EM834388 (Final)	Abstract: ScienceDirect-Abstract Exit Other: ResearchGate-Abstract Exit
Journal Article	Madbouly SA, Xia Y, Kessler MR. Rheokinetics of ring-opening metathesis polymerization of bio-based castor oil thermoset. Macromolecules 2012;45(19):7729-7739.	EM834388 (2012)	Abstract: ACS-Abstract Exit
Journal Article	Paterson AH, Wendel JF, Gundlach H, Guo H, Jenkins J, Jin D, Llewellyn D, Showmaker KC, Shu S, Udall J, Yoo MJ, Byers R, Chen W, Doron-Faigenboim A, Duke MV, Gong L, Grimwood J, Grover C, Grupp K, Hu G, Lee TH, Li J, Lin L, Liu T, Marler BS, Page JT, Roberts AW, Romanel E, Sanders WS, Szadkowski E, Tan X, Tang H, Xu C, Wang J, Wang Z, Zhang D, Zhang L, Ashrafi H, Bedon F, Bowers JE, Brubaker CL, Chee PW, Das S, Gingle AR, Haigler CH, Harker D, Hoffmann LV, Hovav R, Jones DC, Lemke C, Mansoor S, ur Rahman M, Rainville LN, Rambani A, Reddy UK, Rong JK, Saranga Y, Scheffler BE, Scheffler JA, Stelly DM, Triplett BA, Van Deynze A, Vaslin MF, Waghmare VN, Walford SA, Wright RJ, Zaki EA, Zhang T, Dennis ES, Mayer KF, Peterson DG, Rokhsar DS, Wang X, Schmutz J. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature 2012;492(7429):423-427.	EM834388 (2012)	Abstract from PubMed Full-text: Nature-Full Text PDF Exit Abstract: Nature-Abstract & Full Text HTML Exit Other: ResearchGate-Abstract & Full Text PDF Exit
Journal Article	Thunga M, Xia Y, Gohs U, Heinrich G, Larock RC, Kessler MR. Influence of electron beam irradiation on the mechanical properties of vegetable-oil-based biopolymers. Macromolecular Materials and Engineering 2012;297(8):799-806.	EM834388 (2012) EM834388 (Final)	Abstract: Wiley-Abstract Exit
Journal Article	Ye X, Yuan S, Guo H, Chen F, Tuskan GA, Cheng Z-M. Evolution and divergence in the coding and promoter regions of the Populus gene family encoding xyloglucan endotransglycosylase/hydrolases. Tree Genetics & Genomes 2012;8(1):177-194.	EM834388 (2012) EM834388 (Final)	Full-text: Bioenergy Center-Full Text PDF Exit Abstract: Springer-Abstract Exit Other: ResearchGate-Abstract Exit
Journal Article	Ye X, Busov V, Zhao N, Meilan R, McDonnell LM, Coleman HD, Mansfield SD, Chen F, Li Y, Cheng ZM. Transgenic Populus trees for forest products, bioenergy, and functional genomics. Critical Reviews in Plant Sciences 2011;30(5):415-434.	EM834388 (Final)	Abstract: Abstract TAND HTML Exit
Journal Article	Cui H, Hanus R, Kessler MR. Degradation of ROMP-based bio-renewable polymers by UV radiation. Polymer Degradation and Stability 2013;98(11):2357-2365.	EM834388 (Final)	Full-text: Science Direct Full Text HTML Exit
Journal Article	Lin W, Hagen E, Fulcher A, Hren MT, Cheng ZM. Overexpressing the ZmDof1 gene in Populus does not improve growth and nitrogen assimilation under low-nitrogen conditions. Plant Cell, Tissue and Organ Culture (PCTOC) 2013;113:51-61.	EM834388 (Final)	Full-text: Springer Full Text HTML Exit
Journal Article	Lin WL, Cai B, Cheng ZM. Identification and characterization of lineage-specific genes in Populus trichocarpa. Plant Cell, Tissue and Organ Culture (PCTOC) 2014;116:217-225.	EM834388 (Final)	Full-text: Springer Full Text HTML Exit

Supplemental Keywords:

Stress tolerance, sustainability, bio-based resins, pultrusion, composites, somatic embryogenesis, redox chemicals, oxidation, reduction

Relevant Websites:

Cotton Incorporated Exit

Progress and Final Reports:

Original Abstract

2009

2010

2011 Progress Report

2012 Progress Report