Grantee Research Project Results
2000 Progress Report: Genetics of Chlorpyrifos Risk in Minority Populations
EPA Grant Number: R827039C003Subproject: this is subproject number 003 , established and managed by the Center Director under grant R827039
(EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
Center: Center for Research on Early Childhood Exposure and Development in Puerto Rico
Center Director: Alshawabkeh, Akram
Title: Genetics of Chlorpyrifos Risk in Minority Populations
Investigators: Wetmur, James G.
Current Investigators: Wetmur, James G. , Wolff, Mary S.
Institution: Mount Sinai School of Medicine
EPA Project Officer: Callan, Richard
Project Period: August 1, 1998 through July 31, 2003 (Extended to July 31, 2004)
Project Period Covered by this Report: August 1, 1999 through July 31, 2000
Project Amount: Refer to main center abstract for funding details.
RFA: Centers for Children's Environmental Health and Disease Prevention Research (1998) RFA Text | Recipients Lists
Research Category: Children's Health , Human Health
Objective:
The objectives are to:
- Determine paraoxonase and butyrylcholinesterase enzyme kinetics and acetylcho-linesterase activities in maternal and cord blood of ≥ 150 African-American and ≥ 150 Hispanic mother-infant pairs who are part of the study cohort described in Project 2 (R827039C002), as well as ≥ 100 Caucasian mother-infant pairs. One of the substrates for determining the enzyme kinetics will be chlorpyrifos oxon. The substrates for paraoxonase and arylesterase activities of paraoxonase will be selected to distinguish these activities. Butyrylcholinesterase also will be assayed with multiple substrates and inhibitors.
- Determine the frequency of polymorphisms (or mutations) in the paraoxonase and butyrylcholinesterase genes in the same three population groups. For both enzymes, the well established polymorphisms or mutations will be determined. Where the chlorpyrifos oxon and other substrate specificities do not agree with expectation for the known polymorphisms or mutations, the exon sequences and splice junctions will be determined. In samples with a very low enzymatic activity, the two promoters also will be investigated to relate phenotype to genotype.
- Establish an in vitro model for determining the relative contributions of paraoxonase and butyrylcholinesterase to detoxification of low concentrations of chlorpyrifos and related compounds. This phenotypic model will permit conversion of measurements of total exposure to chlorpyrifos to specific exposures to the oxon. The conversion factors for a genotypic model also will be determined.
- Compare the effects of total exposure to chlorpyrifos (Project 2) with specific exposure to chlorpyrifos oxon (phenotypic and genotypic) on the neurodevelopment of exposed neonates in minority populations in East Harlem.
Progress Summary:
Chlorpyrifos, an insecticide implicated as a developmental neurotoxicant in animals, is utilized routinely in the homes of inner city residents. As part of an effort to measure the associated neurodevelopmental risks to specific individuals in this population, the paraoxonase and butyrylcholinesterase enzyme kinetics and acetylcholinesterase activities will be determined in maternal and cord blood of ≥ 150 African-American and ≥ 150 Hispanic mother-infant pairs who are part of the prospective epidemiological study cohort from Project 2, as well as ≥ 100 Caucasian mother-infant pairs. All of the samples studied in this Project are coded by Project 2.
We have received 256 coded whole blood samples from Project 2.
All samples are immediately separated into red cell, buffy coat, and serum fractions. Serum aliquots are stored for subsequent analysis of enzyme activities. DNA is extracted and aliquots are stored for genotyping.
The accomplishments of this project are: Human paraoxonase is a polymorphic (Q191R) arylesterase with 8- to 40-fold differences in serum paraoxonase/arylacetate activity ratios for certain substrates, such as paraoxon and phenylacetate. A second, frequent polymorphism (M54L) leads to a decrease in serum enzyme concentration of 35 percent. Both of the common polymorphisms have been implicated as cardiovascular risk factors in non insulin-dependent diabetic patients. These two polymorphisms are being determined by PCR/restriction fragment length polymorphism (RFLP).
To date, we have completed 206 genotype determinations for the Q191R polymorphism and 230 genotype determinations of the M54L polymorphism.
Butyrylcholinesterase is a suicide substrate for chlorpyrifos oxon and thus may also play a role in protection of the central nervous system. The common polymorphism does not lead to a RFLP. Thus, we use the primer ATTCCATATTTTACAGGAAATGCTGATGAA together with one of two reverse primers ending in AA to determine a common polymorphism in butyrylcholinesterase (BuChE). The sequence following the primer begins with AC or GC. The forward primer mismatches the template at the GC site. The PCR products incorporate an MwoI site, which cleaves at GCN7GC. This technique can usually be employed to allow PCR-RFLP genotyping rather than relying on more complicated dot-blot or allele-specific PCR methods.
To date, we have completed 115 genotyping determinations for this polymorphism.
To date, we have determined baseline butyrylcholinesterase enzymatic activities for 115 serum samples.
Significance
Chlorpyrifos, an insecticide implicated as a developmental neurotoxicant in animals, is utilized routinely in the homes of inner city residents. In collaboration with Project 2, we are endeavoring to measure the associated neurodevelopmental risks specific for certain individuals in this population.
Future Activities:
In the next year, we will continue data collection as subjects are enrolled by Project 2.
Journal Articles on this Report : 1 Displayed | Download in RIS Format
| Other subproject views: | All 1 publications | 1 publications in selected types | All 1 journal articles |
|---|---|---|---|
| Other center views: | All 41 publications | 34 publications in selected types | All 33 journal articles |
| Type | Citation | ||
|---|---|---|---|
|
|
Landrigan PJ, Claudio L, Markowitz SB, Berkowitz GS, Brenner BL, Romero H, Wetmur JG, Matte TD, Gore AC, Godbold JH, Wolff MS. Pesticides and inner-city children:exposures, risks, and prevention. Environmental Health Perspectives 1999;107(Supplement 3):431-437. |
R827039 (2002) R827039C002 (2002) R827039C003 (2000) |
Exit |
Supplemental Keywords:
Health, RFA, Scientific Discipline, PHYSICAL ASPECTS, Geographic Area, Toxics, Susceptibility/Sensitive Population/Genetic Susceptibility, Health Risk Assessment, Physical Processes, pesticides, Risk Assessments, State, Environmental Chemistry, Children's Health, Biochemistry, dietary exposure, disease, health effects, Human Health Risk Assessment, integrated pest management, environmental hazard exposures, sensitive populations, biological response, pesticide exposure, community support, human exposure, pesticide residues, PCB, New York (NY), children, exposure, environmental health hazard, developmental toxicants, assessment of exposure, community-based intervention, PCBs, pest management, human health riskRelevant Websites:
http://www.childenvironment.org/ Exit
Progress and Final Reports:
Original AbstractMain Center Abstract and Reports:
R827039 Center for Research on Early Childhood Exposure and Development in Puerto Rico Subprojects under this Center: (EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
R827039C001 Growing Up Healthy in East Harlem
R827039C002 Exposure to Indoor Pesticides and PCBs and their Effects on Growth and Neurodevelopment in Urban Children
R827039C003 Genetics of Chlorpyrifos Risk in Minority Populations
R827039C004 Prenatal PCB Exposure and Neurodevelopmental Outcomes in Adolescence and Adulthood
R827039C005 Neuroendocrine Mechanisms of Environmental Toxicants: PCBs and Pesticides
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.
Project Research Results
1 journal articles for this subproject
Main Center: R827039
41 publications for this center
33 journal articles for this center