Grantee Research Project Results

2008 Progress Report: Oxidative Stress Responses to PM Exposure in Elderly Individuals With Coronary Heart Disease

EPA Grant Number: R832413C004
Subproject: this is subproject number 004 , established and managed by the Center Director under grant R832413
(EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
Center: Center for Comprehensive, optimaL, and Effective Abatement of Nutrients
Center Director: Arabi, Mazdak
Title: Oxidative Stress Responses to PM Exposure in Elderly Individuals With Coronary Heart Disease
Investigators: Delfino, Ralph , Vaziri, Nosratola D , Staimer, Norbert , Neuhausen, Susan , Gastanaga, Victor
Current Investigators: Delfino, Ralph , Vaziri, Nosratola D , Gillen, Dan , Staimer, Norbert , Neuhausen, Susan , Gastanaga, Victor
Institution: University of California - Irvine
EPA Project Officer: Chung, Serena
Project Period: October 1, 2005 through September 30, 2010 (Extended to September 30, 2012)
Project Period Covered by this Report: October 1, 2007 through September 30,2008
RFA: Particulate Matter Research Centers (2004) RFA Text | Recipients Lists
Research Category: Human Health , Air

Objective:

The overall goal of this study is to advance knowledge on the importance of particle size and composition to the induction of oxidative stress responses in a high-risk population of elderly people with coronary artery disease. We hypothesize that biomarkers of oxidative stress responses will be associated with indoor and outdoor home PM mass and total particle number concentration. Given the interplay between oxidative stress and inflammation, we anticipate this would support the view that PM leads to systemic inflammatory responses. We further hypothesize that biomarkers will be more strongly associated with predicted indoor exposure to PM of outdoor origin (from source tracer analyses). We will also evaluate effects of exposure to specific metals, elemental and organic carbon, and specific organic components used as source tracers. We further hypothesize that biomarker associations with ultrafine and fine PM will be better explained by chemical assays that measure reactive oxygen species and electrophilic activity. Individual susceptibility will also be assessed, including medication use and polymorphisms in genes coding for proteins involved in oxidative stress responses.

Approach:

We will conduct a study of repeated measures to evaluate the relationship between circulating biomarkers of oxidative stress responses and exposure to PM in elderly subjects with CHD. Biomarkers will include: oxidized glutathione (GSSG), reduced glutathione (GSH), an F₂-isoprostane biomarker of lipid peroxidation (8-iso-PGF2α), extracellular superoxide dismutase (SOD) activity, and erythrocyte SOD and glutathione peroxidase 1 activities. The balance of capacity and stress will be represented by the ratio GSH/GSSG, which is expected to decrease with higher PM exposures, while 8-iso-PGF2α , and SOD and GPx-1 activities will increase. Changes in these biomarkers are expected to be associated with cardiovascular outcomes and inflammatory biomarkers measured in the parent study funded by NIEHS. Subjects will include 72 nonsmokers age 65 and older living in retirement homes in areas of the Los Angeles air basin with high concentrations of both freshly emitted and aged PM. Each subject will be followed with blood draws for biomarkers at the end of each of 12 weeks (864 person-days of observation). This intensive follow-up will be spread across 240 monitored days over two years, and include in each year a period of high photochemical activity and a period of high air stagnation to enhance contrasts in PM composition, number and size distribution. Intensive exposure assessments will be made at indoor and outdoor home sites, including methods described under Projects 1 and 3. Data will be analyzed with the general linear mixed model controlling for temporal trends, study site, weather variables, as-needed or inconsistent medication use, respiratory infections and key clinical and subject characteristics. We will also evaluate whether individual characteristics that may increase susceptibility predict associations between oxidative stress biomarkers and PM exposure.

Progress Summary:

Over the period of 9 months of the third year of study, tasks related to data management and analysis has been ongoing. Results from the first one of two years of study panel follow-up were published this year (Delfino et al. 2008). Below we summarized preliminary results from the analysis of both years of data involving repeated measures in 60 subjects. This work represents cumulative progress over three years of funding. Additional laboratory work for biomarkers of oxidative stress is underway. Only methods are briefly described below. Genotyping work for GST M1 and T1 is complete, and analyses of gene-environment interactions are underway.

Analysis of the relationship between biomarkers of antioxidant activity and air pollutants:

As proposed, the Cardiovascular Health and Air Pollution Study (CHAPS) is a panel study with daily repeated measurements of health outcomes and exposures in elderly individuals with a history coronary artery disease. Study subjects ages 65 years or older lived in retirement communities prohibiting indoor tobacco smoke at shared locations and in buildings with common ventilation systems. We have completed follow-up in all four communities in the LA Basin. Retirement communities being studied are located in inland urban areas of the LA Basin considered down-wind smog receptor sites with aged PM, but also affected by local traffic with freshly emitted PM. Evidence from the SCPC show that PM concentrations and components by size-fraction in the LA Basin are expected to vary across sites because of traffic density and transport, and between our two seasonal study periods described below.^1-3

Over a seven month period, each subject is followed in two 6-week blocks with blood draws for circulating biomarkers of inflammation, thrombosis, oxidative stress and antioxidant activity (described below), and measurements of exhaled nitric oxide (NO) at the end of each of 12 weeks. During the 12 weeks of panel follow-up, subjects complete daily personal digital assistant (PDA) or paper diaries for time-place activity, psychosocial stress, medications, and antioxidant vitamin and mineral supplements. The effect of medications such as statins on exposure-response relationships is currently being investigated.

We recruited four retirement communities with an average of 365 residents (range 182-575). From these communities, we recruited 102 subjects who underwent baseline clinical evaluation on site at the University of California Irvine Senior Mobile Van. The clinical work-up included an intake history and physical by study cardiologists, 12-lead ECG, complete pulmonary function tests, blood tests including CBC, fasting lipid profile and fasting glucose. Confirmation of CAD diagnosis was made with a medical records review (e.g. positive stress test, MI history). Twenty-one subjects were not eligible and 17 dropped out prior to or after the start of the panel study, or had too few biomarker observations (< 5 of 12 weeks) leaving 64 subjects, 32 from the first year of study (2005-06), and 32 currently being followed in year 2. In year 1, two of the 32 subjects had insufficient or invalid biomarker data, in part due to exclusions for frequent infections. One of 32 subjects in year 2 had frequent infections and another had biomarker data that was beyond the upper range of standard curve, leaving 60 subjects ages 71-96 years with 5-12 weekly blood draws (N=578) (Table 1).

Table 1. Characteristics of subjects in CHAPS (N=60)

Characteristic	Mean ±SD or N (%)
Age (years)	84.1 ± 5.60
BMI (kg/m²)	26.8 ±3.87
Gender	34 (56.7%) Males, 26 (43.3%) Females
Cardiovascular History
Confirmation of CAD:^a
-Myocardial infarction	27 (45.0%)
-Coronary artery bypass graft or angioplasty	20 (33.3%)
-Positive angiogram or stress test	10 (16.7%)
-Clinical diagnosis^b	3 (5.0%)
Current angina pectoris	18 (30.0%)
Pacemaker or defibrillator	13 (21.7%)
Cardiac arrhythmia	16 (26.7%)
Congestive heart failure	13 (21.7%)
Hypertension	42 (70.0%)
Hypercholesterolemia	43 (71.7%)
Other Medical History
Type II Diabetes	8 (13.3%)
COPD or Asthma	9 (15.0%)
Stroke or transient ischemic attack	8 (13.3%)
Medications
ACE inhibitors and Angiotensin II receptor antagonists	24 (40.0%)
HMG-CoA reductase inhibitors (statins)	31 (51.7%)
Platelet Aggregation Inhibitors or Coumadin	21 (35.0%)
Calcium Channel Blockers	21 (35.0%)
Smoking history
Never smoker	34 (57.6%)
Ex-smoker (no smoking last 12 months)	25 (42.4%)

^a Each category is hierarchical - excludes being in above diagnostic category

^b coronary microvascular disease

In 2005-2006, subjects in two retirement communities were followed in four alternating six-week phases (groups 1-2). Again in 2006-2007, subjects in another two retirement communities were followed in four alternating six-week periods (groups 3-4). We collected six weeks of data in each community during a warmer period of higher photochemical activity (July-early Oct, phase 1), and six weeks of data in each community during a cooler period of higher air stagnation (late Oct-Feb, phase 2).

We recently published results of an analysis of biomarker data from the first of two years of the panel study (Delfino et al. 2008). The analysis included 30 elderly residents in the first two retirement communities. We are also completing a similar analysis of the 60 subjects that includes data from the second year. We focused analyses of data for both years on biomarkers that were informative in the year 1 analysis. We assayed weekly concentrations of plasma CRP, TNF-a and its soluble receptor (sTNF RII), IL-6 and its receptor IL-6 sR, and soluble P-selectin by ELISA. Erythrocyte GPx and SOD activities were assayed spectrophotometrically.

Air pollutant exposure measurements included hourly indoor (i) and outdoor (o) home pollutant gases, total particle number (PN), PM_2.5 elemental carbon (EC), PM_2.5 organic carbon (the most volatile fraction, OC₁, and the least volatile fractions, OC_2-4), and aethelometer black carbon (BC). We also measured size fractionated PM mass, condensation mode (quasi-ultrafine) particles, 0-0.25 mm in diameter (PM_0.25), accumulation mode particles, 0.25-2.5 mm in diameter (PM_0.25-2.5), and coarse mode particles, 2.5-10 mm in diameter (PM_2.5-10) collected with impactor samplers

We also estimated indoor and outdoor secondary organic carbon (SOC) from total OC and primary OC (OC_pri) from total OC as described in our recent publication.⁴ Briefly, the contributions of primary and secondary OC to measured outdoor OC were estimated from collected OC and EC concentrations using EC as a tracer of primary combustion-generated OC (i.e. “EC tracer method”).⁵ The study average outdoor SOC accounted for 40% of outdoor particulate OC (40-45% in the summer and 32-40% in the winter). Air exchange rates and infiltration factors (F_inf) at each site were also determined. Estimated F_inf and measured particle concentrations were then used in a single compartment mass balance model to assess the contributions of indoor and outdoor sources to measured indoor OC, EC, PM_2.5 and PN. We assume that indoor exposures to PM of outdoor origin are relevant to personal exposures given that people spend most of their time indoors.

Exposure-response data were analyzed with mixed linear models controlling for temperature and excluding weeks subjects had infections. The model also takes into account between-group exposure effect; within-group, between-phase exposure effect; and the within-subject, within-phase exposure effect that is the parameter of interest.

In the analysis of the two years of data, we confirmed our published findings involving the first year of data, and many associations were more significant as anticipated. Many positive associations were found for EC, OC (mostly OC_pri), BC, PN, CO and NO₂ with IL-6, sTNF RII, and sP-selectin. Associations of these air pollutants with CRP and TNF-α were also found, but limited to the upper distribution of thee biomarkers. Generally, the strongest and most significant associations for particle mass were for quasi-ultrafine PM_0.25, except for sP-selectin, which was more strongly associated with PM_0.25-2.5. Most associations were strongest for longer-term averages out to the last 9 days. In addition, associations were stronger for estimated indoor PM of outdoor origin than for raw indoor exposures. This suggests that outdoor particles were important. P-selectin is derived predominantly from activated platelets. It is critical for initial leukocyte adhesion to platelets and endothelial cells, activates leukocytes and endothelial cells,⁶ and may play a crucial role in the development of neointimal formation after arterial injury.⁷ Associations of air pollutants with sP-selectin were stronger in subjects not taking platelet aggregation inhibitors while association with sTNF RII and CRP were stronger among subjects not taking statins.

Using a leave-one-out approach and individual autoregression models we found that five influential subjects showed significant positive associations between pollutants and SOD, and three influential subjects showed significant positive associations between pollutants and GPx. In the remaining subjects, significant inverse associations were found for erythrocyte SOD and GPx with the same exposures above. Inverse associations were found for erythrocyte SOD and quasi-ultrafine PM_0.25 plus PM_0.25‑2.5 and PM_2.5‑10, although associations were stronger overall for SOD with quasi-ultrafine PM_0.25. Inverse associations were similarly stronger for GPx with both PM_0.25 and PM_2.5‑10 as compared with PM_0.25‑2.5. These findings suggest enzyme inactivation within erythrocytes by pollutant components or ultrafine particles in most subjects. We do not know why a small number of other subjects show positive responses. Again, for SOD and GPx we found that indoor PM of outdoor origin was often more informative. As with the similar finding for biomarkers of inflammation like IL-6, this suggests that outdoor particles were important even though subjects spend a majority of their time indoors.

It is conceivable that antioxidant enzyme inactivation is in part responsible for pollutant-related increase in biomarkers of inflammation and thrombosis such as IL-6 and sP-selectin. This is supported by a finding of within-subject inverse associations of IL-6 with GPx, and sP-selectin with SOD. In our publication of the year 1 results (Delfino et al. 2008) we present a discussion of the possible role of these erythrocyte antioxidant enzymes in air pollution health effects.

In addition, associations of some biomarkers (IL-6, sP-selectin, and SOD) with markers of primary combustion (EC, BC, OC_pri), particle number, and PM_0.25 were stronger in the cooler 6-week period than the warmer 6- week period of follow-up. Primary OC and particle number were higher in cooler months characterized by air stagnation and lower secondary particle growth. Interestingly, concentrations of other pollutants that were more strongly associated with IL-6 and SOD in the cooler phase (EC, BC, and PM_0.25) were not higher then, suggesting differences in particle composition were important, perhaps as better reflected by OC_pri.

These results suggest that emission sources of primary PM_2.5 OC, quasi-ultrafine particles and related particle number concentrations lead to sustained increased systemic inflammation, platelet activation, and decreased circulating erythrocyte antioxidant enzymes in elderly people with coronary artery disease. Such effects may be partly behind reported morbidity and mortality associations.

Pilot Study of Exhaled Hydrocarbons:

We tested the utility of using exhaled breath gases as a marker for oxidative stress in one of four retirement communities (Riverside). A series of different trace hydrocarbons are being evaluated as possible exposure or response biomarkers. We first tested whether exhaled ethane and n-pentane predicted exhaled NO and to indoor/outdoor gas pollutants in order to evaluate ethane and n-pentane as potential markers of oxidative stress, which is potentially related to airway inflammation. Exhaled ethane and pentane are possible lipid peroxidation products. In this study, 16 elderly subjects were sampled and the exhaled breath was analyzed using canister sampling and GC/GC-MS analysis (Sherwood Rowland-Blake Laboratory, Department of Chemistry, University of California Irvine). Exhaled ethane and pentane concentrations were subtracted from indoor ethane and pentane concentrations measured in the same manner. Offline exhaled NO was determined using procedures recommended by the American Thoracic Society and European Respiratory Society. We tested criteria pollutant gases as the only predictor variables of exhaled ethane and pentane. We only used pollutant gases since they were measured with fewer missing data on the 12 days of sampling (Friday afternoons) and we were also interested in testing whether ethane and pentane were simply exposure markers of volatile air pollutants.

There was a strong correlation between the breath and room hydrocarbon concentrations (R²= 0.99 and 0.37, p = 0.0005 and 0.02, for ethane and n-pentane, respectively). Assuming a linear relationship between breath and room hydrocarbon concentrations, least-squares analysis of the data give slopes of 1.06 ± 0.05 for ethane and 1.06 ± 0.10 for n-pentane. Slopes larger than one indicate that the rate of clearance from the lung is larger than the uptake within the lung. Thus, both hydrocarbons are slightly elevated in the breath samples in comparison to the room samples, although within the uncertainties, the breath/room ratio for n-pentane is indistinguishable from one.

No associations were found between exhaled hydrocarbon species and exhaled NO. Instead, exhaled hydrocarbons adjusted for indoor hydrocarbon concentrations were associated with indoor and outdoor air pollutants (NO, NO₂ and CO), suggesting air pollutant exposures are driving exhaled hydrocarbon concentrations. This may be secondary to residual ethane and n-pentane in the airways not adjusted for by subtracting room ethane and n-pentane from exhaled breath concentrations. However, because exhaled NO is not necessarily reflected by levels of lipid peroxidation, additional work will include an analysis of the relationship of biomarkers of oxidative stress (especially carbonylated proteins) to ethane and n-pentane.

Genotyping work:

The Glutathione S-transferase M1 (GSTM1) gene is located at chromosome 1p13.3. The homologous recombination between two almost identical 4.2 Kb regions flanking the GSTM1 gene resulted in a 16Kb deletion containing the entire gene. It is so-called null allele of the GSTM1 gene. Similarly, null allele was reported in the GSTT1 gene, another member of the glutathione S-transferase family. A triplex PCR were used to amplify the wild-type allele of the GSTM1 gene, the wild-type allele of the GSTT1 gene, and the interleukin 5 receptor-alpha (IL5RA) gene that served as the internal control to monitor the DNA quality of each sample. PCR primers are listed in the Table 2.

Table 2 primer sequences for the triplex PCR

Primers*	primer sequence	expected size of PCR product
GSTM1-1F:	CTGCCCTACTTGATTGATGGG	273 bp
GSTM1-1R:	CTGGATTGTAGCAGATCATGC	273 bp
GSTT1-1F	TTCCTTACTGGTCCTCACATCTC	480 bp
GSTT1-1R	TCACCGGATCATGGCCAGCA	480 bp
IL5RA-3602F	TTCACCGCACATTGCACATTAGGG	334 bp
IL5RA-3936R	AGTGGAAATGGTGTTGCCACCTTG	334 bp

*Primer sequences for the amplification of GSTT1 gene and GSTM1 gene are from Bailey et al ⁸

The absence of 273-bp PCR product in a DNA sample indicates of the presence of the homozygous null allele of GSTM1 gene, and, on the other hand, the absence of the 480-bp PCR product indicates the presence of the homozygous null allele of GSTT1 gene, if good DNA quality in that sample can be confirmed by the success amplification of 334 bp PCR product in the IL5RA gene. PCR amplification in 4 subjects failed for all of the three genes, which indicate that DNA quality for those samples may be poor. After being purified by Zymo-clean column, those samples worked well in the following PCR except one sample. For that sample, DNA was re-extracted from 0.5 ml of another batch of whole blood and PCR reactions were done using this DNA. PCR bands were successfully observed for both the GSTM1 and the GSTT1 gene. Out of 56 subjects genotyped so far, we found 27 subjects (48%) were homozygous GSTM1 null, and 6 subjects (11%) were homozygous GSTT1 null.

Expected Results:

We expect to clarify findings in the epidemiologic literature of associations between ambient PM and cardiovascular mortality and hospital admissions. Results of this study will advance knowledge on the acute effects of ultrafine and fine particles on biomarkers of oxidative stress responses that are relevant to acute and chronic cardiovascular outcomes. Results are expected to inform policy makers on the sources, particle components, size fractions and concentrations that affect key intermediate endpoints in the progression of atherosclerosis and in acute changes in cardiovascular function and thrombosis. We will advance understanding of the adverse effects of particulate air pollutants on the cardiovascular health of high-risk individuals living in ethnically diverse neighborhoods with high exposures to airborne pollutants.

Future Activities:

Analysis of stable peroxidation end products to assess oxidative stress

1. Lipid peroxidation products: Cooperation has been established between UCI’s mass spectrometry facility (Department of Chemistry) and our laboratory. As a result we have started to develop an immunoaffinity chromatography linked LC/MS method for 8-isoprostane measurements in plasma that combines the simple sample preparation of immunoassays with the sensitivity and selectivity of mass spectroscopic technologies. Preliminary analytical recovery studies succeeded in the detection of deuterated 8-isoprostane standards by LC/MS in the lower pg range. We are in the process of optimizing the method for analyzing actual plasma by adding an immunoaffinity purification step.

2. Oxidized proteins: The alteration of proteins as a result of oxidative stress can be assessed by measuring the carbonyl groups of the oxidized proteins. We are in the process of evaluating Cell Biolabs’ Protein Carbonyl ELISA kit for rapid detection and quantitation of protein carbonyls in plasma samples. In this assay, the wells of a 96-well plate are first coated with protein samples and then react with dinitrophenylhydrazine (DNP) to mark the carbonyl residues. The derivatized protein carbonyls will be probed with an anti-DNP antibody, followed by an HRP conjugated secondary antibody. The protein carbonyl concentration in unknown plasma samples will be quantified by comparing with known concentrations of reduced and oxidized BSA standards.

Analysis of the above biomarkers of oxidative stress in relation to air pollutant measurements will be conducted in the next year. We have analyzed data for exhaled hydrocarbons to estimate in vivo lipid peroxidation and will compare this data with carbonylated proteins in plasma to assess the validity of the hydrocarbons as noninvasive biomarker.

Other genotyping work proposed will begin in year 4. We will complete some analyses of gene-environment interactions starting with GSTM1 and GSTT1.

References:

1. Zhu, Y., Hinds, W.C., Kim, S., Shen, S. and Sioutas, C. Seasonal trends of concentration and size distributions of ultrafine particles near major high in Los Angeles. Aerosol Science and Technology 2004; 38(Suppl 1):5-13.

2. Fine, P.M., Si, S., Geller, M.G., and Sioutas, C. Inferring the sources of fine and ultrafine PM at downwind receptor areas in the Los Angeles Basin using multiple continuous monitors. Aerosol Science and Technology, 2004a; 38:182-195.

3. Fine, P.M., Chakrabarti, B, Krudysz M., Schauer J.J. and Sioutas, C. Seasonal, spatial, and diurnal variations of individual organic compound constituents of ultrafine and accumulation mode PM in the Los Angeles Basin. Environmental Science and Technology, 2004b; 38:1296-304.

4. Polidori A, Arhami M, Delfino RJ, Allen R, Sioutas C. Indoor-outdoor relationships, trends and carbonaceous content of fine particulate matter in retirement communities of the Los Angeles basin. J Air Waste Manage Assoc, 2007; 57:366-379.

5. Cabada JC, Pandis SN, Subramanian R, Robinson AL, Polidori A, Turpin B. Estimating the Secondary Organic Aerosol Contribution to PM2.5 Using the EC Tracer Method. Aerosol Sci Technol 2004;38:140–155.

6 Jurk K, Kehrel BE. Platelets: physiology and biochemistry. Semin Thromb Hemost 2005;31:381-92.

7 Wang K, Zhou X, Zhou Z, Mal N, Fan L, Zhang M, Lincoff AM, Plow EF, Topol EJ, Penn MS. Platelet, not endothelial, P-selectin is required for neointimal formation after vascular injury. Arterioscler Thromb Vasc Biol 2005;25:1584-9.

8. Bailey LR, Roodi N, Verrier CS, Yee CJ, Dupont WD, Parl FF. Breast cancer and CYPIA1, GSTM1, and GSTT1 polymorphisms: evidence of a lack of association in Caucasians and African Americans. Cancer Res. 1998;58(1):65-70.

Journal Articles on this Report : 1 Displayed | Download in RIS Format

Publications Views
Other subproject views:	All 35 publications	15 publications in selected types	All 15 journal articles
Other center views:	All 241 publications	157 publications in selected types	All 157 journal articles

Publications
Type	Citation	Sub Project	Document Sources
Journal Article	Delfino RJ, Staimer N, Tjoa T, Polidori A, Arhami M, Gillen DL, Kleinman MT, Vaziri ND, Longhurst J, Zaldivar F, Sioutas C. Circulating biomarkers of inflammation, antioxidant activity, and platelet activation are associated with primary combustion aerosols in subjects with coronary artery disease. Environmental Health Perspectives 2008;116(7):898-906.	R832413 (2007) R832413 (2008) R832413 (2009) R832413 (Final) R832413C001 (2007) R832413C001 (2008) R832413C001 (Final) R832413C004 (2007) R832413C004 (2008) R832413C004 (2009) R832413C004 (2010) R832413C004 (Final)	Full-text from PubMed Abstract from PubMed Associated PubMed link Full-text: EHP-Full Text PDF Abstract: EHP-Abstract and Full Text HTML

Supplemental Keywords:

Health effects, human health, sensitive populations, dose-response, enzymes, genetic polymorphisms. particulates, epidemiology, environmental chemistry, modeling,, RFA, Health, Scientific Discipline, Air, particulate matter, Health Risk Assessment, Risk Assessments, Biochemistry, Ecology and Ecosystems, elderly adults, particulates, atmospheric particulate matter, human health effects, PM 2.5, airway disease, cardiovascular vulnerability, airborne particulate matter, air pollution, human exposure, vascular dysfunction, cardiovascular disease, human health risk

Progress and Final Reports:

Original Abstract

Main Center Abstract and Reports:

R832413 Center for Comprehensive, optimaL, and Effective Abatement of Nutrients

Subprojects under this Center: (EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
R832413C001 Contribution of Primary and Secondary PM Sources to Exposure & Evaluation of Their Relative Toxicity
R832413C002 Project 2: The Role of Oxidative Stress in PM-induced Adverse Health Effects
R832413C003 The Chemical Properties of PM and their Toxicological Implications
R832413C004 Oxidative Stress Responses to PM Exposure in Elderly Individuals With Coronary Heart Disease
R832413C005 Ultrafine Particles on and Near Freeways

Top of Page

The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.