Grantee Research Project Results
2005 Progress Report: Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins
EPA Grant Number: R829479C021Subproject: this is subproject number 021 , established and managed by the Center Director under grant R829479
(EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
Center: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program
Center Director: Schumacher, Dorin
Title: Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins
Investigators: Cheng, Zong-Ming
Institution: University of Tennessee
EPA Project Officer: Aja, Hayley
Project Period: October 1, 2004 through September 30, 2007 (Extended to December 31, 2007)
Project Period Covered by this Report: October 1, 2004 through September 30, 2005
RFA: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program (2001) RFA Text | Recipients Lists
Research Category: Hazardous Waste/Remediation , Targeted Research
Objective:
The objectives of this research project are to: (1) construct the transformation vectors with the already cloned metallohistin cDNA agNt84 under control by constitutive promoter CaMV35S; (2) transfer the genes into a woody plant, a Populus hybrid, and annual plants, Brassica napus and B. juncea, and confirm transformation by polymerase chain reaction (PCR) and Southern blot; (3) determine levels of RNA and protein expression in different tissues; (4) characterize the transgenic plants for their metal accumulation capacity and phytoremediation potential; and (5) determine the short- and long-term effects of the overexpression of metallohistin on growth and development of the transgenic plants.
Progress Summary:
Objective 1: To Construct the Transformation Vectors With the Already Cloned Metallohistin cDNA agNt84 Under Control By Constitutive Promoter CaMV35S
AgNt84 was PCR amplified from the initial cDNA clone using forward 5’CAGCGGATCCCATTGTCTCCAATCCTCTTCA3’ and reverse primer 5’TGACGAGCTCAGACGTACGTACAACTGATAGCAT3’, which introduced BamHI and SacI sites, respectively. The BamHI-SacI fragment was then ligated into pBI121, in front of a CaMV35S promoter as shown in Figure 1. The vector was introduced into Agrobacterium tumefaciens strain GV3850.
Figure 1. pBINAgNt84: Binary Vector Used for Transformation
Objective 2: To Transfer the Genes Into a Woody Plant, a Populus Hybrid, and Annual Plants, Brassica juncea, and To Confirm Transformation by Polymerase Chain Reaction and Southern Blot
Because Populus and Brassica transformation is slower, we proceeded to transform tobacco and Arabidopsis to evaluate the construct. Arabidopsis thaliana ecotype Col1 plants were transformed by the floral dip method [1] and Nicotiana tabacum cv Xanthi were transformed by the leaf disc transformation method.
Objective 3: To Determine Levels of RNA and Protein Expression in Different Tissues
Expression of AgNt84 was confirmed by northern blot (Figure 2). The protein, however, was in an unextractable form, tightly bound to the cell wall. Immunostaining of cell wall pellets showed a strong fluorescent signal from transgenic plants compared to controls (Figure 3).
Figure 2. Northern Blot of Transgenic Arabidopsis Lines. Ten μg total RNA was run and probed with the AgNt84 cDNA clone. Bottom panel is 18S RNA shown for equal loading.
Figure 3. Immunostaining of Pellets From Cell Wall Protein Extraction Show That AgNt84 is Still Tightly Bound Within the Cell Wall. Immunostaining was with rabbit preimmune and anti-AgNt84 immune serum, followed by incubation with FITC-linked goat anti-rabbit IgG as the secondary antibody.
Objective 4: To Characterize the Transgenic Plants for Their Metal Accumulation Capacity and Phytoremediation Potential
Preliminary experiments were conducted to assess the metal binding ability of transgenic plants by a dithiazone staining method. Tobacco plants hydroponically grown in 5 mM MES buffer without Cd showed no staining characteristic of Cd accumulation. When grown on buffer containing 200 mM Cd(NO3)2, staining was observed starting from day 1 in root tissue (Figures 4 and 5 and Table 1).
rubber band disk
tube buffer band
Figure 4. Hydroponically Grown Tobacco Plants. The first two figures are diagrams of the setup of the hydroponic containers, and the remaining pictures are of the plants at various steps in the metal uptake experiment. A. A diagram of the disk in the container. The view is through the opening of the petri dish container. The disk can easily be moved in and out of the container, which facilitates rinsing the plants. Each plant is placed in a hole in the disk. B. A diagram of the setup of the hydroponic container. The disk is above the buffer or media so that the roots are in contact. In addition, the microfuge tubes hold up the disk to allow the disk to remain above the buffer or media. C. Picture of tobacco plants hydroponically grown in MS. D. Tobacco plants in the process of being rinsed with water in the laminar flow hood. E. Tobacco plants in MES buffer containing 200 μM Cd(NO3)2 4H2O. A bigger lid was used to accommodate the size of the plants. The picture was taken after the plants were rinsed with water.
Figure 5. Metal Binding in Transgenic Tobacco: Dithizone Staining of Tobacco WT and Transgenic Lines T12 and T17 Hydroponically Grown in the Presence or Absence of 200 mM Cd (NO3)2. Arrows indicate staining resulting from the formation of Cd dithizonate. The color of dithizonate ranges from an orange-red to red-violet color in order of increasing Cd concentration in the tissue. Intense staining is observed with transgenic plants compared to WT.
Table 1. Cadmium Uptake of T10, T12, T17, and Wild-Type Tobacco on 200 mm Cd. Blank areas indicate where sample was lost during processing, and NC indicates where no calculation was done because the amount of cadmium was below detection levels. A. Blank samples. B. Day1 samples. C. Day 3 samples.
A. Blanks – No Incubation With Cadmium.
Shoot |
Root |
Total dry mass (g) |
||||||
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
|
WT |
0.41 |
0.017 |
4.09 |
WT |
0.07 |
0.0015 |
2.14 |
0.48 |
WT |
0.43 |
<0.001 |
NC |
WT |
0.07 |
<0.001 |
NC |
0.50 |
WT |
0.32 |
0.001 |
0.31 |
WT |
0.07 |
<0.001 |
NC |
0.39 |
10 |
0.26 |
<0.001 |
NC |
10 |
0.05 |
<0.001 |
NC |
0.31 |
10 |
0.06 |
<0.001 |
NC |
10 |
0.06 |
<0.001 |
NC |
0.06 |
10 |
024 |
0.014 |
5.71 |
10 |
0.05 |
0.0046 |
9.2 |
0.29 |
12 |
0.13 |
<0.001 |
NC |
12 |
0.04 |
<0.001 |
NC |
0.17 |
12 |
0.30 |
<0.001 |
NC |
12 |
0.05 |
<0.001 |
NC |
0.35 |
12 |
0.22 |
<0.001 |
NC |
12 |
0.04 |
0.0046 |
11.5 |
0.26 |
17 |
0.30 |
<0.001 |
NC |
17 |
0.07 |
<0.001 |
NC |
0.37 |
17 |
0.23 |
<0.001 |
NC |
17 |
0.03 |
<0.001 |
NC |
0.26 |
B. Day 1 – Incubation With Cadmium for 1 Day.
Shoot |
Root |
Total dry mass (g) |
||||||
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
|
WT |
0.30 |
4.879 |
1,626 |
WT |
0.06 |
4.880 |
8,133 |
0.36 |
WT |
0.19 |
0.988 |
520 |
WT |
0.05 |
3.669 |
7,338 |
0.24 |
WT |
0.23 |
0.333 |
145 |
WT |
0.08 |
3.334 |
4,168 |
0.31 |
WT |
0.16 |
0.311 |
194 |
WT |
0.04 |
2.181 |
5,453 |
0.20 |
WT |
0.21 |
1.226 |
584 |
WT |
0.05 |
6.070 |
12,140 |
0.26 |
10 |
0.33 |
1.686 |
511 |
10 |
0.07 |
6.000 |
8,571 |
0.40 |
10 |
0.16 |
10 |
0.03 |
5.860 |
19,533 |
0.19 |
||
10 |
0.22 |
2.576 |
1,171 |
10 |
0.05 |
8.280 |
16,560 |
0.27 |
12 |
0.16 |
1.309 |
818 |
12 |
0.04 |
4.786 |
11,965 |
0.20 |
12 |
0.16 |
1.275 |
797 |
12 |
0.02 |
4.126 |
20,630 |
0.18 |
12 |
0.22 |
3.170 |
1,441 |
12 |
0.05 |
7.290 |
14,580 |
0.27 |
17 |
0.22 |
1.850 |
841 |
17 |
0.07 |
7.540 |
10,771 |
0.29 |
17 |
0.29 |
3.421 |
1,180 |
17 |
0.07 |
6.460 |
9,229 |
0.36 |
C. Day 3 – Incubation With Cadmium for 3 Days.
Shoot |
Root |
Total dry mass (g) |
||||||
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
Tobacco Line |
g |
mg/L Cd |
mg Cd/g dry wt. |
|
WT |
0.07 |
1.973 |
2,819 |
WT |
0.10 |
5.490 |
5,490 |
0.17 |
WT |
0.41 |
2.505 |
611 |
WT |
0.13 |
7.110 |
5,469 |
0.54 |
WT |
0.24 |
WT |
0.11 |
5.370 |
4,881 |
0.35 |
||
WT |
0.23 |
WT |
0.04 |
3.280 |
8,200 |
0.27 |
||
WT |
0.34 |
1.094 |
322 |
WT |
0.15 |
6.910 |
4,607 |
0.49 |
WT |
0.31 |
2.834 |
914 |
WT |
0.08 |
9.360 |
11,700 |
0.39 |
WT |
0.18 |
1.618 |
899 |
WT |
0.05 |
5.980 |
11,960 |
0.23 |
10 |
0.77 |
7.460 |
969 |
10 |
0.16 |
14.360 |
8,975 |
0.93 |
10 |
0.18 |
3.384 |
1,880 |
10 |
0.04 |
8.140 |
20,350 |
0.22 |
10 |
0.35 |
5.610 |
1,603 |
10 |
0.08 |
12.110 |
15,138 |
0.43 |
12 |
0.21 |
12 |
0.07 |
10.230 |
14,614 |
0.28 |
||
12 |
0.17 |
0.976 |
574 |
12 |
0.02 |
4.792 |
23,960 |
0.19 |
12 |
0.29 |
4.202 |
1,450 |
12 |
0.11 |
11.400 |
10,364 |
0.40 |
12 |
0.28 |
2.005 |
716 |
12 |
0.07 |
7.760 |
11,086 |
0.35 |
12 |
0.22 |
10.440 |
4,745 |
12 |
0.06 |
7.430 |
12,383 |
0.28 |
17 |
0.20 |
2.646 |
1,323 |
17 |
0.06 |
6.580 |
10,967 |
0.26 |
17 |
0.21 |
3.691 |
1,758 |
17 |
0.26 |
7.970 |
3,065 |
0.47 |
17 |
0.43 |
2.635 |
618 |
17 |
0.13 |
16.080 |
12,369 |
0.56 |
Objective 5: To Determine the Short- and Long-Term Effects of the Overexpression of Metallohistin on Growth and Development of the Transgenic Plants
Overall, transgenic plants appeared normal, indicating that overexpression of a metallohistin gene did not interfere with normal plant cell metabolism.
Future Activities:
After we demonstrated the feasibility in plants (tobacco and Arabidopsis), we are in the process of transforming Populus and Brassica juncea. After transformation is confirmed, we will characterize metal binding and accumulations.
Journal Articles:
No journal articles submitted with this report: View all 1 publications for this subprojectSupplemental Keywords:
sustainable industry, waste, agricultural engineering, bioremediation, environmental engineering, new technology, innovative technology, bioaccumulation, biodegradation, bioenergy, bioengineering, biotechnology, phytoremediation, plant biotechnology, bioremediation, carcinogen, contamination, phytodegradation, pollutant, toxicity, heavy metal, environmental cleanup,, Scientific Discipline, TREATMENT/CONTROL, Waste, POLLUTANTS/TOXICS, Biology, Molecular Biology/Genetics, Treatment Technologies, Biochemistry, Bioremediation, Chemicals, Technology, heavy metals, metallohistins, biotechnology, phytoremediation, plant-based remediation, plant uptake studies, transgenic plantsRelevant Websites:
Progress and Final Reports:
Original AbstractMain Center Abstract and Reports:
R829479 The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program Subprojects under this Center: (EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
R829479C001 Plant Genes and Agrobacterium T-DNA Integration
R829479C002 Designing Promoters for Precision Targeting of Gene Expression
R829479C003 aka R829479C011 Biological Effects of Epoxy Fatty Acids
R829479C004 Negative Sense Viral Vectors for Improved Expression of Foreign Genes in Insects and Plants
R829479C005 Development of Novel Plastics From Agricultural Oils
R829479C006 Conversion of Paper Sludge to Ethanol
R829479C007 Enhanced Production of Biodegradable Plastics in Plants
R829479C008 Engineering Design of Stable Immobilized Enzymes for the Hydrolysis and Transesterification of Triglycerides
R829479C009 Discovery and Evaluation of SNP Variation in Resistance-Gene Analogs and Other Candidate Genes in Cotton
R829479C010 Woody Biomass Crops for Bioremediating Hydrocarbons and Metals
R829479C011 Biological Effects of Epoxy Fatty Acids
R829479C012 High Strength Degradable Plastics From Starch and Poly(lactic acid)
R829479C013 Development of Herbicide-Tolerant Energy and Biomass Crops
R829479C014 Identification of Receptors of Bacillus Thuringiensis Toxins in Midguts of the European Corn Borer
R829479C015 Coordinated Expression of Multiple Anti-Pest Proteins
R829479C016 A Novel Fermentation Process for Butyric Acid and Butanol Production from Plant Biomass
R829479C017 Molecular Improvement of an Environmentally Friendly Turfgrass
R829479C018 Woody Biomass Crops for Bioremediating Hydrocarbons and Metals. II.
R829479C019 Transgenic Plants for Bioremediation of Atrazine and Related Herbicides
R829479C020 Root Exudate Biostimulation for Polyaromatic Hydrocarbon Phytoremediation
R829479C021 Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins
R829479C022 Development of Herbicide-Tolerant Energy and Biomass Crops
R829479C023 A Novel Fermentation Process for Butyric Acid and Butanol Production from Plant Biomass
R829479C024 Development of Vectors for the Stoichiometric Accumulation of Multiple Proteins in Transgenic Crops
R829479C025 Chemical Induction of Disease Resistance in Trees
R829479C026 Development of Herbicide-Tolerant Hardwoods
R829479C027 Environmentally Superior Soybean Genome Development
R829479C028 Development of Efficient Methods for the Genetic Transformation of Willow and Cottonwood for Increased Remediation of Pollutants
R829479C029 Development of Tightly Regulated Ecdysone Receptor-Based Gene Switches for Use in Agriculture
R829479C030 Engineered Plant Virus Proteins for Biotechnology
The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.
Project Research Results
Main Center: R829479
212 publications for this center
45 journal articles for this center