Skip to main content
U.S. flag

An official website of the United States government

Here’s how you know

Dot gov

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

HTTPS

Secure .gov websites use HTTPS
A lock (LockA locked padlock) or https:// means you have safely connected to the .gov website. Share sensitive information only on official, secure websites.

  • Environmental Topics
  • Laws & Regulations
  • Report a Violation
  • About EPA
Contact Us

Grantee Research Project Results

Complex Sphingolipid Involvement in the Expression of CYP1A1 Activity in MC-Exposed HepG2 Cells

EPA Grant Number: U915823
Title: Complex Sphingolipid Involvement in the Expression of CYP1A1 Activity in MC-Exposed HepG2 Cells
Investigators: Peters, DeMia E.
Institution: Clark Atlanta University
EPA Project Officer: Lee, Sonja
Project Period: August 1, 2000 through August 1, 2002
Project Amount: $62,155
RFA: Minority Academic Institutions (MAI) Fellowships for Graduate Environmental Study (2000) RFA Text |  Recipients Lists
Research Category: Ecological Indicators/Assessment/Restoration , Academic Fellowships

Objective:

The objectives of this research project are to experimentally determine: (1) whether the modulation of CYP1A1 activity by ISP1 is paralleled by modulation of CYP1A1 protein amount in treated cells; and (2) if sphingolipids act at the level of transcription by quantitating CYP1A1 mRNA levels and protein levels before and after treatment of cells with 3-methylcholanthrene (MC) alone and MC plus ISP1/FB1.

Approach:

HepG2 cells will be grown in Dulbecco's Modified Eagle's Medium (DMEM), pH 7.4, supplemented with glucose, sodium bicarbonate, penicillin, streptomycin, and 10 percent fetal bovine serum, and maintained at 370?C in an atmosphere of 5 percent CO2. At confluency, DMEM without the serum supplement will be utilized and the cells will be treated. For treatment, the cells will be incubated with 5 mM MC (for maximal CYP1A1 induction); MC with 1 mM ISP1; or MC, ISP1 and 5 mM C2-ceramide. After the 18-hour treatment period, cells will be rinsed in ice-cold PBS, homogenized in 1 ml of 0.1 M sodium phosphate buffer (pH 7.6) and frozen in -700?C until assay. CYP1A1 will be assessed by monitoring one of its associated activities, ethoxyresorufin O-deethylase (EROD). Messenger RNA will be reverse transcribed using the polymerase chain reaction (PCR) apparatus to be utilized as a probe. A 631-base pair long CYP1A1 cDNA fragment (from 190 to 821) will be amplified by PCR using two oligonucleotides, 5'-sense: GGCCTGAAGAATCCACCAGGG and 3'-antisense: GGTAGGTAGCGAAGAATAGGG (56). This fragment will be digested with PstI and PvuII and subcloned into the PstI and SmaI sites of plasmid pT3T7a18. The plasmid will be purified and then sequenced to ensure that the cDNA is at the desired sequence. Once the desired probe has been sequenced, the RNA from the cells then will be analyzed by Northern blotting.

Expected Results:

Investigations prior to this project showed that in HepG2 cells, 3-methylcholanthrene increased CYP1A1 activity 20- to 30-fold. However, this induction was significantly suppressed by inhibitors of sphingolipid synthesis (FB1 and ISP1). Neither of these compounds affected basal CYP1A1 activity. Induction of CYP1A1 activity by 3-methylcholanthrene was restored by addition of C2-ceramide to the cells. Therefore, these studies uncovered a requirement for complex sphingolipids during the induction of CYP1A1 by the PAH. The purpose of this study is to determine the apparent role that sphingolipids play in the signal transduction pathway used by MC to induce CYP1A1 activity.

Supplemental Keywords:

CYP1A1, methylcholanthrene, HepG2 cells, EROD, Northern blotting., RFA, Ecosystem Protection/Environmental Exposure & Risk, Scientific Discipline, Ecological Indicators, Ecosystem Protection, Ecology, Biology, Ecosystem/Assessment/Indicators, exploratory research environmental biology, Environmental Microbiology, Ecological Effects - Environmental Exposure & Risk, Biochemistry, Ecological Effects - Human Health, Chemical Mixtures - Environmental Exposure & Risk, Ecology and Ecosystems, cellular physiology, cellular biology, ecological exposure, HepG2 cells, microbiology, CYP1A1 activity, sphingolipids, methylcholanthrene

Progress and Final Reports:

  • 2001
  • Final
  • Top of Page

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.

    Site Navigation

    • Grantee Research Project Results Home
    • Grantee Research Project Results Basic Search
    • Grantee Research Project Results Advanced Search
    • Grantee Research Project Results Fielded Search
    • Publication search
    • EPA Regional Search

    Related Information

    • Search Help
    • About our data collection
    • Research Grants
    • P3: Student Design Competition
    • Research Fellowships
    • Small Business Innovation Research (SBIR)
    Contact Us to ask a question, provide feedback, or report a problem.
    Last updated April 28, 2023
    United States Environmental Protection Agency

    Discover.

    • Accessibility
    • Budget & Performance
    • Contracting
    • EPA www Web Snapshot
    • Grants
    • No FEAR Act Data
    • Plain Writing
    • Privacy
    • Privacy and Security Notice

    Connect.

    • Data.gov
    • Inspector General
    • Jobs
    • Newsroom
    • Open Government
    • Regulations.gov
    • Subscribe
    • USA.gov
    • White House

    Ask.

    • Contact EPA
    • EPA Disclaimers
    • Hotlines
    • FOIA Requests
    • Frequent Questions

    Follow.