Grantee Research Project Results
2007 Progress Report: Development and Evaluation of an Innovative System for the Concentration and Quantitative Detection of CCL Pathogens in Drinking Water
EPA Grant Number: R833003Title: Development and Evaluation of an Innovative System for the Concentration and Quantitative Detection of CCL Pathogens in Drinking Water
Investigators: Tzipori, Saul , Walt, David , Zuckermann, Udi
Current Investigators: Tzipori, Saul , Zuckermann, Udi , Walt, David
Institution: Tufts University , Tufts Cummings School of Veterinary Medicine
Current Institution: Tufts University
EPA Project Officer: Aja, Hayley
Project Period: August 1, 2006 through August 1, 2009 (Extended to July 31, 2011)
Project Period Covered by this Report: August 1, 2006 through August 1, 2007
Project Amount: $600,000
RFA: Development and Evaluation of Innovative Approaches for the Quantitative Assessment of Pathogens in Drinking Water (2005) RFA Text | Recipients Lists
Research Category: Water , Drinking Water
Objective:
In a previous EPA STAR award we had developed optimized and validated at Tufts University a novel method, the continuous flow centrifugation or CFC, for the concentration of three protozoa (Cryptosporidium spp./ Guardia/, Microsporidia) from large volumes of water (1000L).
The specific objectives of this project are to: (1) optimize the parameters (flow rate, centrifugal force, various bowls, elusion buffers, etc) in order to recover representative pathogens which include E. coli for bacteria, Microcystis aeruginosa for algae and MS2 bacteriophages for viruses. In this Objective, we will systematically optimize the concentration methodology for each representative pathogen with a view to generate reproducibly robust data; (2) integrate the concentration of protozoa (validated in the pervious award), bacteria, algae and viruses from water into a single concentration procedure. The PCFC will then be fine tuned for its ability to simultaneously concentrate representative pathogens from each group of the CCL list and; (3) focus on the detection and quantitative identification of CLL pathogens in water,using multiplex miniaturized fiber optic bead microarrays coupled with a compact confocal-type imaging system and comparing it with EPA approved methods.
Progress Summary:
Interim Results
A portable automated continuous flow centrifuge was constructed and a disposable bowl was modified to include a positive charged matrix. The portable equipment is light (~25 pounds), and operates with multiple power sources (220/110AC, 12DC), which enables both lab and field operation. The disposable harness kit is composed of a modified centrifuge bowl, plastic tubing and collection bags. The concentration/elution procedure is user friendly and cost effective.
The overall automated process involves the following steps: a) Concentration – a peristaltic pump delivers a water sample through a modified bowls inlet port, the large particles such as protozoa, bacterial spores/cells and other suspended material is being concentrated due to the strong centrifugal forces and the much cleaner water sample is forced to flow through the positively charged inner core where as the negatively charged viruses are captured by the strong electrostatic attraction, eliminating the clogging issues which are common in standard filtration components. b) Automated Elution: protozoa/bacteria are dislodged by the addition of detergent and agitation, and the viruses which are trapped in the virus matrix are released using a protein buffer which inverts the positive charge in the core. The both virus and protozoa/bacteria concentrates are delivered to a sterile bag. The bags could be processed in the field by using portable detection kits or transported to the laboratory.
The complete description of the automated concentration/elution cycle is as follows:
Concentration: Prior to concentration the disposable harness is assembled in the machine according to the schematic layout. The elution buffers are injected (5 mL bacteria/protozoa, 20 mL virus) into the designated plastic bags using a Lauer lock syringe and the inlet tubing is placed into a 10 L plastic cubitainer containing the water sample. The power source is turned on and the required protocol is selected. During concentration of the water sample, pathogens are retained inside the centrifuge bowl at 9000rpm. The water sample is driven through the centrifuge bowl while it is spinning at 0.5 L/min by the peristaltic pump, which results in the retention of larger particles; protozoa and bacteria, on the wall of the disposable plastic centrifuge bowl. Smaller particles such as virus, which escape the centrifugal forces are forced through the positively charged filter material in the out-flow chamber of the core and are adsorbed to the material.
Elution of bacteria and protozoa: After concentration the residual liquid is subjected to a bacteria and protozoa elution cycle. 5 mL of elution buffer is delivered through the inlet port of the bowl from the designated PVC bag. The bacteria/protozoa elution buffer is a 5xPBS and 0.06% Tween 80 solution used as a detergent to dislodge bacteria and protozoa that have compacted to the walls of the bowl during the concentration process.
Once the elution buffer has been added, the centrifuge spins to a speed of 7000 rpm and then is immediately braked until it comes to a complete stop to dislodge the bacteria and protozoa. The cycle of spinning and braking is repeated several times with a 10 second interval between each cycle. Upon completion of the final spin and brake cycle the 275 mL eluate is pumped from the inlet port of the bowl and returned to the PVC bag that originally contained the elution buffer. The centrifuge is then spun at 9000 rpm for 1 minute to extract any residual liquid from the out-flow chamber of the core, which is subsequently pumped from the inlet to the rest of the eluate. The entire volume is split into two equal aliquots of approx 140 mL for separate analysis of bacteria and protozoa.
Elution of Virus: Following the bacteria and protozoa elution cycle, 10 mL of virus elution buffer is pumped into the out-flow chamber of the core through the outlet port of the bowl from the designated PVC bag. The virus elution buffer is composed of beef extract, glycine and Tween 80 which neutralize the positive charge of the material inside of the core and helps to dislodge the virus that were adhered during the concentration process.
After addition of the elution buffer it saturates the filter material inside the core for 5 minutes at which point the centrifuge is spun for 1 minute at 9000 rpm to extract the liquid from the out-flow chamber of the core into the bowl. A second volume of 10 mL of virus buffer is pumped into to out-flow chamber and the process is repeated. The cycle ends by pumping the entire volume of virus eluate, approximately 20 mL, from the inlet port to the PVC bag that originally contained the virus elution buffer.
Cryptosporidium oocysts, Bacillus anthracis spores and MS2 bacteriophages were simultaneously spiked in 10-50L tap and turbid surface water samples, resulting in mean recoveries of 40%, 35%, and 50% respectively.
Table 1: Recovery of C. parvum oocysts, MS2 bacteriophages and B. anthracis from 10 and 50 L tap water samples using a modified bowl and manually operated concentrator |
||||||
|
|
|
|
|||
Vol. analyzed |
Spike dose |
Percent Recovery |
Spike dose |
Percent recovery |
Spike dose |
Percent recovery |
(L) (# replicates) |
oocysts |
oocysts |
MS2(pfu) |
MS2(pfu) |
Bacillus(cfu) |
Bacillus(cfu) |
|
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
10 (11) |
100 +/- 2.5 |
39.7 +/- 4.9 |
2.1*107 +/- 8.3*106 |
56.0 +/- 32.3 |
46.8 +/- 38.3 |
37.0 +/- 15.6 |
50 (3) |
100 +/- 2.5 |
31.3 +/- 9.0 |
1.0*107 +/- 1.7*107 |
71.1 +/- 50.0 |
12.7 +/- 15.9 |
59.6 +/- 4.3 |
Table 2 : Recovery of C. parvum oocysts, MS2 bacteriophage and B. anthracis from 10 L tap water samples using a modified bowl and an automated concentrator |
|
||||||
|
|
|
|
||||
Vol. analyzed |
Spike dose |
Percent Recovery |
Spike dose |
Percent recovery |
Spike dose |
Percent recovery |
|
(L) (# replicates) |
oocysts |
oocysts |
MS2(pfu) |
MS2(pfu) |
Bacillus(cfu) |
Bacillus(cfu) |
|
|
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
|
10 (7) |
100 +/- 2.5 |
40.0 +/- 12.2 |
2.6*107 +/- 1.3*107 |
48.1 +/- 28.2 |
23.3 +/- 4.6 |
43.6 +/- 16.4 |
Table 3: Recovery of C. parvum oocysts, MS2 bacteriophages and B. anthracis from 10 L tap water samples using a modified bowl and an automated concentrator |
|
|
||||
|
|
|
||||
Vol. analyzed |
Spike dose |
Percent recovery |
Spike dose |
Percent recovery |
Spike dose |
Percent recovery |
(L) (# replicates) |
oocysts |
oocysts |
MS2(pfu) |
MS2(pfu) |
Bacillus(cfu) |
Bacillus(cfu) |
|
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
(mean +/- SD) |
10 (10) |
100 +/- 2.5 |
55.67 +/- 7.5 |
176.2 +/- 131.24 |
4.29 +/- 2.04 |
28.2 +/- 7.86 |
40.13 +/- 20.21 |
Preliminary development of the multiplexed fiber optic microarray has begun, using a sandwich assay technique developed by Ahn et al. (Appl Environ Microbiol. 2006 Sep; 72 (9):5742-9). By detecting ribosomal RNA (rRNA), which accounts for up to 80% of total bacterial RNA, or ~20,000 copies / cell of E. coli, we do not anticipate a need for nucleic acid amplification. Fiber optic bundles, with ~50,000 individually addressable fibers, are etched with acid to produce microwell arrays. A slurry of microspheres is then added to the distal end of the fiber using a pipet and the microspheres self assemble into the wells by electrostatic forces and capillary action. Amine-modified microspheres are encoded with discrete concentrations of fluorescent dye and then covalently linked to oligonucleotide capture probes. Using Array Designer 2.0 software (Premier Biosoft International, Palo Alto, CA), we are designing sequences for capture and signal probes for the sandwich assay based on GenBank accession numbers acquired from the literature. The specificity of all probe sequences is confirmed via BLAST searches. The probes designed thus far are outlined below in Table 4.
Table 4: Current capture and signal probes under development for the multiplexed array
Probe |
Probe Sequence 5’→3’ |
GenBank |
Length |
EC001-CP |
GAGCAAAGGTATTAACTTTACTCCCTTCCT |
J01695;AE005174 |
30 |
EC001-SP |
ACTTGTAACAGTTCTTCTTGTAGTAGAGG |
AE005174 |
29 |
SSP003-L-CP |
ATCTCTGGATTCTTCTGTGGATGTC |
AF276989;U90318;X80681 |
25 |
SSP003-L-CP |
ATCTCTGGATTCTTCTGTGGATGTCAA |
U90318 |
|
AE001c |
TGCTGCCTCCCGTAGGAGTC |
|
20 |
Arrays will be validated and thoroughly characterized with both synthetic and cultured targets as additional sensors are added to the array. Fluorescently-labeled synthetic targets provide a means to test the specificity of capture probes and the success of probe-microsphere coupling. The bead-based sandwich assay platform has been proven to be both specific and flexible. Specificity is enhanced by using two hybridization events and high stringency washes. Additional microsphere types will be designed and added to tailor the arrays to the analytical problem and as cultured and field samples are made available.
Future Activities:
Over the next 2 years Objectives 2 and 3 will be accomplished as follows:
Objective 2: to assess the recoveries of microorganisms from the CCL list (i.e., Coxsackievirus A9, Microcystis aeruginosa, Aeromonas hydrophila, and Enchephalytozoon intestinalis), we will conduct spiking experiments to evaluate the simultaneous concentration system and write up standardized procedure protocol(s).
Objective 3: we will focus on the detection and quantitative identification of CLL pathogens in water,using multiplex miniaturized fiber optic bead microarrays coupled with a compact confocal-type imaging system and comparing it with EPA approved methods. The major strength of this method compared with others currently being developed, is that it requires no nucleic acid amplification step.
Supplemental Keywords:
RFA, Scientific Discipline, Water, Environmental Chemistry, Environmental Monitoring, Drinking Water, Environmental Engineering, pathogens, CCL, continuous flow centrifugation, drinking water monitoring, E. Coli, analytical methods, cryptosporidium , contaminant removal, drinking water contaminants, drinking water treatment, Giardia, other - risk management, contaminant candidate listProgress and Final Reports:
Original AbstractThe perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.