Grantee Research Project Results
2000 Progress Report: Development of a Rapid, Quantitative Method for the Detection of Infective Coxsackie and Echo Viruses in Drinking Water
EPA Grant Number: R828040Title: Development of a Rapid, Quantitative Method for the Detection of Infective Coxsackie and Echo Viruses in Drinking Water
Investigators: Yates, Marylynn V. , Mulchandani, Ashok , Chen, Wilfred
Institution: University of California - Riverside
EPA Project Officer: Hahn, Intaek
Project Period: February 1, 2000 through February 1, 2002
Project Period Covered by this Report: February 1, 2000 through February 1, 2001
Project Amount: $321,784
RFA: Drinking Water (1999) RFA Text | Recipients Lists
Research Category: Drinking Water , Water
Objective:
The objective of this research project is to improve the current analytical methods for quantitative detection of infective nonpolio enteroviruses (NPEV) in drinking water. The specific objectives of this research are to:
· Develop a molecular-beacon-based (MB) reverse transcription-polymerase chain reaction (RT-PCR) method to detect NPEV.
· Establish a potential correlation between ion mobility spectroscopy (IMS)-MB-RT-PCR detection and cell culture detection for infective viruses.
· Using the molecular beacon, develop and evaluate real-time monitoring of virus replication in cell culture.
· Evaluate the above methods to quantify the presence of infective NPEV in concentrated drinking water samples.
Progress Summary:
Our goal in the first year was to develop a molecular beacon-based RT-PCR assay for the detection of enteroviruses. The initial efforts were centered on the selection of primers and the design of molecular beacons.
Primer Design and Selection. Two sets of primers were initially designed to amplify the noncoding regions of the enterviruses. Primer set 1 consisted of EHCO1 CTCCGGCCCCTGAATACGGCT and EHO2 TGTCACCATAAGCAGCC and primer set 2 consisted of ENTERO1 TCCGGCCCCTGAATGCGGCT and ENTERO2 TGTCACCATAAGCAGCC. Both primer sets were designed to amplify a 149-base pair (bp) fragment.
Using coxsackie virus B6 as the template, the efficiency of amplification was compared between the two primer sets. As shown in Figure 1, Primer Set 2 gave a much stronger signal at both 59 and 62 C annealing temperatures. This Primer Set was used for all subsequent experiments.
Figure 1. Comparison of Amplification Efficiency Between Primer Sets 1 and 2
Molecular Beacon Design. A molecular beacon (MB) was designed to complementarily target the internal region of the PCR amplicon. The MB (5'-6-FAM-cgagcgGCAGCGGAACCGACTACTTTGGG-TGcgctcg -DABCYL-3') was purchased from the Midland Certified Reagent company (Midland, MI) and contains a 25-bp probe moiety, which is flanked by two 6-bp arms (underlined).
Thermal Denaturing Profile. To determine the optimal recording temperature for the real-time RT-PCR assay, the thermal denaturing profiles of the beacon in the presence or absence of a perfectly complementary oligo were investigated using a BioRad iCycler. Figure 2 shows the fluorescence variation as a function of temperature. The profile confirms that, at low temperatures, the arms of the MB form a hairpin structure, therefore inhibiting fluorescence. A suitable annealing temperature could be chosen so that the MB will remain anneal to the amplicon and the resulting fluorescence should be significantly above the background fluorescence. A temperature ranging from 40-60°C was determined to be suitable.
Figure 2. Thermal Denaturing Profile of Hepatitis a Virus Molecular Beacon
Real-Time Detection by 2-Step RT-PCR. A 2-step RT-PCR assay was developed for the detection of Echo 11. The samples were initially held at 95°C for 5 minutes. The reverse transcription was performed under the following conditions: 25°C for 10 minutes, 42°C for 60 minutes, and 100°C for 5 minutes. PCR was performed as follows: 95°C for 5 minutes, then followed by 40 cycles of denaturation at 95°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 1 minute, and one cycle at 100°C for 5 minutes. As shown in Figure 3, only reactions containing Echo 11 RNA were detected by the molecular beacons. For the sample with no templates (NTC), no increase in fluorescence was observed. As a confirmation of this observation, the PCR samples were analyzed on a 2.5 percent agarose gel. The results were consistent with the real-time RT-PCR. The 149 bp amplicons were detected only in the presence of HAV templates.
Figure 3. Real-Time Detection of Echo 11 Viruses With Molecular Beacons
Sensitivity of the Real-Time RT-PCR. The sensitivity of the real-time RT-PCR assay was evaluated using both PCR primers and random hexamers for the RT reaction. Ten-fold serial dilutions of template RNA isolated from Echo 11 were used for the assay (see Figure 4). Any fluorescent signal that is 10-fold higher than the standard deviation of the mean baseline emission was indicative of a positive detection. Using this criterion, the detection limit of the real-time PCR assay was determined to be 0.5 PFU. The use of PCR primers for the RT reaction resulted in higher signal than the random hexamers.
Figure 4. Sensitivity of the Real-Time RT-PCR Assays
Future Activities:
In the second year of the project, we will combine the assay with IMS and cell culture to establish a quantitative viability test for enteroviruses. Also, we will test the specificity of the RT-PCR assay with other echo and coxsackie viruses as well as viruses from other groups. We will initiate our investigation on the real-time detection of virus infection in cell culture.
Journal Articles:
No journal articles submitted with this report: View all 5 publications for this projectSupplemental Keywords:
coxsackie, echo virus, drinking water, nonpolio enteroviruses, NPEV., RFA, Scientific Discipline, Water, Health Risk Assessment, Environmental Chemistry, Environmental Microbiology, Drinking Water, Environmental Monitoring, community water system, emerging pathogens, echo viruses, treatment, water quality, monoclonal antibodies, microbiological organisms, infectious disease, microbial risk management, monitoring, groundwater disinfection, analytical methods, infective coxsackie, drinking water contaminants, exposure, drinking water treatment, quantitative cell culture, detection, fluorogenic probes, exposure and effectsProgress and Final Reports:
Original AbstractThe perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Conclusions drawn by the principal investigators have not been reviewed by the Agency.