2012 Progress Report: Environmental Research and Technology Transfer Program of The Consortium for Plant Biotechnology Research, Inc.

EPA Grant Number: EM834388
Center: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program
Center Director: Schumacher, Dorin
Title: Environmental Research and Technology Transfer Program of The Consortium for Plant Biotechnology Research, Inc.
Investigators: Bonning, Bryony C. , Cheng, Zong-Ming , Kessler, Michael , Pantalone, Vincent R , Paterson, Andrew , Qu, Rongda , Ren, Shuxin , Yang, Guochen
Institution: Iowa State University , North Carolina State University , University of Georgia , University of Tennessee - Knoxville
EPA Project Officer: Hahn, Intaek
Project Period: January 1, 2009 through December 31, 2012 (Extended to December 31, 2013)
Project Period Covered by this Report: January 1, 2012 through December 31,2012
Project Amount: $1,706,000
RFA: Targeted Research Center (2009) Recipients Lists
Research Category: Targeted Research , Consortium for Plant Biotechnology

Objective:

Iowa State University- Bryony C. Bonning

Objective of Research: The overall goal of this project was determine whether an aphid gut binding peptide such as GBP3.1 can be combined with the Bt-derived cytolytic toxin for production of aphicidal toxins. Our ultimate goal is to produce transgenic plants that are aphid resistant. The objectives of this research project were to (i) determine which peptide characteristics are essential for binding to the aphid gut, and (ii) insert the gut binding residues into a Bt-derived cytolytic toxin, and test the modified toxins for stability in and increased binding to the aphid gut, and for toxicity. We have successfully completed both project objectives and as a consequence have developed an effective novel approach for management of aphid pests.

University of Tennessee - Vincent Pantalone

The long-term objective of this research is to develop a commercially acceptable, environmentally superior, high yielding soybean variety with low seed phytate. We have four specific aims:

  1. Production of low phytate soybean seeds to enable multiple environment field research and pilot plant research processing of soy meal.
  2. Analytical testing of the improved low phytate soybean seeds.
  3. Chicken feeding trials to document enhanced nutrition.
  4. Insertion of a novel industry proprietary RFO transgene to soybean that modifies expression as an alternative strategy to improve livestock nutrition and metabolic growth rates.

North Carolina State University - Rongda Qu

Objectives:

  1. Test AtAVP1, and maize CBP (calcium binding domain of careticulin) transgenic rice lines, and F1 progeny of the CBP-expressing transgenic rice lines crossed with AVP1-expressing transgenic rice lines for drought tolerance.
  2. Test AtAVP1, and maize CBP (calcium binding domain of careticulin) transgenic rice lines, and F1 progeny of the CBP-expressing transgenic rice lines crossed with AVP1-expressing transgenic rice lines for salt stress tolerance.

Virginia State University - Shuxin Ren

Objective 1: Test the null hypothesis that there is no difference in field growth characteristics and seed traits (maturity, height, lodging resistance, seed yield, protein concentration, amino acid composition of the protein, oil concentration, fatty acid composition of the oil, and inorganic phosphorous content) between TN09-239 and USG 5601T.

Objective 2: Test the hypothesis that DNA collected from vegetative leaf tissue can distinguish whether the plant will produce seeds at harvest that will contain normal versus low levels of phyate, by evaluating two genetic loci: SSR markers SATT237 (chromosome 3, linkage group N) and SATT561 (chromosome 19, linkage group L).

Objective 3: Extend the knowledge of SSR molecular markers to develop a test of single nucleotide polymorphisms (SNPs) at two genetic loci controlling soybean seed phytate.

North Carolina A&T State University - Guochen Yang

Objectives:

  • To perform salt tolerance assays of transgenic rice plants in collaboration with NCSU's CPBR-funded project.
  • Student training through fellowship: actively engaged students in the area of plant tissue culture related to transformation, molecular breeding and environmental research.

University of Tennessee - Zong-Ming Cheng

Objective 1: To characterize the transgenic plants for enhanced tolerance to high and low temperature, drought and flooding.

Objective 2: To determine whether the PtXTH22 promoter can be used as a broad stress-inducible promoter.

Objective 3: To characterize the promoter of the PtXTH22 gene.

Iowa State University - Michael Kessler

The goal of this project is to develop bio-based resins, prepared by co-polymerization of agricultural oils (e.g., corn, linseed, and soybean) and derivatives, with commercially available co-monomers, for the manufacture of fiberglass-reinforced composites used in pultrusion processing. Pultrusion is a continuous manufacturing process for creating composites with a constant cross-section. In the pultrusion process (shown schematically in Figure 1 below), the fiber reinforcement is impregnated with the resin matrix and pulled through a heated die where it is shaped and cured in one continuous step.

Figue 1.Schematic of the pultrusion process

The specific objectives for the 2-year project are the following:

  1. develop appropriate resin formulations with the right combination of processing viscosity, cure kinetics, and ultimate thermo-mechanical properties for pultrusion processing.
  2. determine the best processing conditions for the pultruded fiberglass/bio-resin systems in order to maximize the thermo-mechanical properties of the composites and economics of the system, and
  3. evaluate the long-term strength and durability of the composites compared to existing polyester materials through accelerated aging and environmental exposure testing.

University of Georgia - Andrew Paterson

Objectives:

  • Paired-end sequencing of about 120,000 BACs, roughly equally sampling the two libraries described above, to be done by subcontract to a fee-for-service vendor selected on a competitive basis.
  • Computational analysis of the resulting sequence assembly by several tests to identify possible errors, conducted in the PI's lab as described (Paterson, et al., 2009), including:
    1. Comparison to the order of sequence-tagged-sites along the (~1 cM density) cotton genetic map (Rong, et al., 2004), to investigate accuracy across regions of several cM or more;
    2. Comparison to the order of overgo and BAC-end sequences in BAC clones comprising the physical map (detailed above), testing contiguity of regions of less than the ~1 cM resolution of the genetic map, down to the ~100 kb average size of a BAC;
    3. Comparison to the Arabidopsis genome, the most complete angiosperm genome and the closest relative of cotton that has been fully sequenced. We have previously shown appreciable microsynteny and even some regions of macrosynteny between Arabidopsis and cotton (Rong, et al., 2005a). A sequence scaffold would not be expected to show long stretches of cotton-Arabidopsis synteny if incorrectly assembled. However, because there will surely be many (hundreds?) small rearrangements between these taxa, synteny information will be used only to support other lines of evidence, and the assembly will never exclusively rely on synteny to support any genome arrangement.

Georgia Institute of Technology - Gerald Pullman

Hypothesis 1: Natural redox agents control redox potential in developing female gametophyte and embryo.
Objective 1: Use LC/MS and LC/MS/MS to confirm and extend preliminary results to identify and profile ascorbic acid (reduced), dehydroascorbate (oxidized), glutathione (reduced) and glutathione disulfide (oxidized) in female gametophyte and embryo tissues.

Hypothesis 2: Redox potential controls somatic embryo development in vitro.
Objective 2: Run early-stage, maturation, and germination somatic embryo growth tests with natural redox chemicals.
Objective 3: Run early-stage, maturation, and germination somatic embryo growth tests with alternative redox chemicals.
Objective 4: Measure ascorbic acid (reduced), dehydroascorbate (oxidized), glutathione (reduced) and glutathione disulfide (oxidized) in somatic embryos to determine if target concentrations found in zygotic embryos are achieved during growth in vitro.

Hypothesis 3: Medium redox potential changes over time due to air exposure, tissue growth and medium components.
Objective 5: Determine medium redox potential change over time due to air exposure and tissue growth.
Objective 6: Develop methods to control medium redox potential to desired levels over time and in presence of growing somatic embryos.

Progress Summary:

Iowa State University- Bryony C. Bonning

Specific Aim 2. Construct novel Cyt proteins with aphid toxicity. The goal of this aim was to develop aphid active Cyt2Aa by introducing an aphid gut binding peptide (Liu, et al., 2010) into the toxin. The three-dimensional structure of Cyt2Aa (Li, et al., 1996) indicates the presence of seven exposed loops. Loop 6, which is believed to be involved in toxicity, was not modified (Perez, et al., 2005). Constructs for addition to (Cyt2Aa-GBP3.1-Addition-Loopn, CGALn), or substitution (Cyt2Aa-GBP3.1-Substitution-Loopn, CGSLn) of the Cyt2Aa loops with the 12 amino acid GBP3.1 have been made. Five modified toxins (CGAL1, CGAL3, CGAL4, CGSL1 and CGSL4) retained control toxicity against A. aegypti larvae and exhibited significant increase in aphicidal toxicity (previous report).
 
Relative binding of wild type Cyt2Aa CGALn and CGSLn to pea aphid gut BBMV: Changes in the ability of Cyt2Aa to bind to pea aphid gut proteins following introduction of GBP3.1 were examined by pull down assay. Figure 1 shows binding of CGALn and CGSLn mutants. Binding of Cyt2Aa to pea aphid gut BBMV was not detected in these assays. Toxin constructs with loop 4 modifications (CGAL4 and CGSL4) along with CGAL3, and CGSL1 and CGAL7 showed the highest levels of binding in pull down assays. It is notable that all of the modified toxins, including those with reduced toxicity relative to Cyt2Aa, bound aphid gut BBMV in these assays, demonstrating that toxin binding does not always correlate with toxicity.
 
 
 
Surface plasmon resonance (SPR) was used to quantify the relative binding of Cyt2Aa and five of the modified toxins (CGAL1, CGAL3, CGAL4, CGSL1 and CGSL4) to small unilamellar vesicles (SUV) prepared from pea aphid gut BBMV (Fig. 3b). Association and dissociation profiles were similar for all six toxins. The extent of binding at the end of injection of CGAL1, CGAL3, CGAL4, CGSL4 was significantly higher than that of Cyt2Aa (one-way ANOVA, p < 0.05). The extent of binding of Cyt2Aa at the end of injection was not significantly different from that of CGSL1 (p = 0.070).
 
 
                                 
TEM analysis of physiological damage caused by CGSL4: Pea aphids (second instar) were fed on a single concentration (100 μg/ml) of CGAL1 or wild type Cyt2Aa in complete artificial diet by membrane feeding assay. Control aphids were fed on diet only. After 72 hr, aphids were processed for transmission electron microscope analysis. CGAL1 caused significant damage to the pea aphid gut microvilli (Figure 3) compared to the control, in which the microvilli are densely packed. Wild type Cyt2Aa also showed some damage to the gut microvilli; however, it was not as severe as observed for CGAL1-fed aphids where almost complete loss of the microvilli was observed.
 
Cyt2Aa with multiple GBP3.1 peptide insertions: Two Cyt2Aa-GBP3.1 mutants (CGAL134 and CGSL14) with incorporation of GBP3.1 peptide sequence into multiple Cyt2Aa loops. CGAL134 and CGSL14 expressed and purified, tested control toxicity against mosquito larvae, tested toxicity to pea aphid through membrane feeding assay (Febvay, et al., 1988), assessed relative binding of these mutants to pea aphid gut BBMV in pull down assays (Pérez, et al., 2005).
 
Changes in the ability of Cyt2Aa to bind to pea aphid gut proteins following introduction of GBP3.1 were examined by pull down assay. Little binding was seen for CGAL134 to the pea aphid gut BBMV whereas no binding was seen for wild type Cyt2Aa and CGSL14 under optimized experimental conditions (Figure 4). There was no band present in the BBMV only control lane. The difference in the abilities of CGAL134 and CGSL14 to bind to pea aphid gut BBMV proteins may result from differences in the accessibility of the GBP3.1 peptide.
 
Mosquitocidal activity of CGAL134 and CGSL14 was determined by Aedes aegypti feeding assays with nine different concentrations for LC50 estimation. However, both toxins showed reduced toxicity. Aphid feeding assay data on day 4 for CGAL134 and CGSL14 indicate that neither toxin was toxic to A. pisum. Higher concentrations of the toxin (50 and 100 µg/ml) showed increased mortality.
 
 
 
University of Tennessee
 
In 2009, through backcrossing and molecular marker technology, we created the low phytate line TN09-239.  We validated gene transfer of two low phytate recessive genes into our high yielding commercial line 5601T by utilizing the simple sequence repeat (SSR) markers Satt 237 and Satt 561. These markers are linked to chromosomal locations on linkage group N (Chromosome 3) and L (Chromosome 19) that govern soybean seed phytate (Scaboo, et al., 2009). In that work, our lab confirmed QTL cq-Pha-001, a major allele affecting seed phytate, and cq-Pha-002, which has a smaller affect. This remains a major accomplishment of this research and has allowed us to move forward.
 
Our success in confirming the two low phytate soybean loci led to increased collaboration with USDA-ARS scientists (Drs. Bilyeu and Gillman) at Columbia, MO, in the discovery of soybean gene sequence with complete association between the low phytate phenotype in soybean and homozygosity for mutant alleles of the two low phytic acid lpa1 homologs (Gillman, et al., 2009).  Molecular marker assays then were designed as perfect markers for the low phytate trait so that molecular breeders can use SNP technology to directly select with absolute accuracy the mutant alleles that control the low phytate phenotype. 
 
Over the duration of this research we secured additional funding and institutional investment to purchase a new Roche Lightcycler 480 for the University of Tennessee Soybean Molecular Marker Laboratory, which upgraded our DNA laboratory and enabled us to utilize the newly developed SNP markers. Based on double helix melting temperatures of PCR products using SNP simple probes in our laboratory, we have increased our efficiency of detecting the two low phytate alleles as demonstrated in Table 1 and Figure 1. We also have been able to measure inorganic phosphorous concentrations using a modified version of a colorimetric assay developed by Raboy, et al. (2000) and measured with a BioTek PowerWave spectrophotometer.
 
We produced seed stocks in the 2010 winter nursery to enter low phytate TN09-239 to the 2010 USDA Southern Uniform Preliminary Test. The experiment was planted at 12 field trial sites in 9 states, with 2 replications, throughout the southern region:  Rohwer, AR, Pine Tree, AR, Ullin, IL, McCune, KS, Pittsburg, KS, Queenstown, MD, Portageville, MO, Stoneville, MS, Plymouth, NC, Kinston, NC, Jackson, TN, and Warsaw, VA.  The multi-environment field test was used to gauge the agronomic and seed quality performance of TN09-239 relative to its recurrent parent commercial cultivar 5601T, in order to gauge commercial opportunity. The low phytate line TN09-239 was equivalent to its recurrent parent 5601T for seed protein concentration (405 g Kg-1 for TN09-239 vs. 403 g Kg-1 for 5601T), seed oil concentration (202 g Kg-1 for TN09-239 vs. 201 g Kg-1 for 5601T), reaction to soybean cyst nematode HG types 1.2.5.7 and 5.7, stem canker resistance score, flower, pubescence, and pod color, and days to plant maturity. However, the seed yield of the low phytate line TN09-239 (2,714 Kg ha-1) was 85% the yield of 5601T (3,185 Kg ha-1) and not at commercial yield levels. It was notable that TN09-239 (at 114 cm plant height) was significantly taller than 5601T (at 74 cm plant height). This contributed to higher plant lodging score and reduced seed yield in TN09-239.
 
Thus, we had to continue to use single nucleotide polymorphism (SNP) technology, specifically our confirmed molecular markers cq-Pha-001and cq-Pha-002, to select individual plant progenies with 100% accuracy for each of the two low phytate genes. We have used SNP markers this year to confirm that our most recent phytate lines are double homozygous recessive for the two alleles that express low phytate concentration in soybean seeds. These lines are BC5 derivatives of the high yielding recurrent parent commercial cultivar 5601T and donor low phytate line TN09-239, both developed by our program.
 
The BC5 derived lines 56CX-1273 and 56CX-1283 have as common parents 5601T and our donor low phytate line TN09-239.  We had speculated in the past that TN09-239 was segregating at the Dt1 locus on chromosome 19 (LGL) where the dominant form of that locus has the indeterminate growth habit. The two genes for low phytate were introgressed originally from the indeterminate line CX 1834-2, and one of the genes (Pha-002) resides on LG L, approximately 18 cM from the Dt1 locus. Selection for that low phytate locus likely brought along the dominant form of the relatively close Dt1 locus. The indeterminate trait (Dt1) in a MG V soybean would lead to excessive plant height, contribute to lodging, and possibly reduce yield. The fifth backcross that we performed to the recurrent parent 5601T was done specifically to harvest BC5F2 single plants that appeared determinate (dt1dt1), and to increase recovery of the parent genome 5601T.  Both 56CX-1273 and 56CX-1283 demonstrated a determinate growth habit in our yield trial, which likely contributed to their increased yields. Breaking the genetic linkage between the indeterminate trait and the second low phytate locus was an important milestone accomplished this year.
 
A major goal of this project was to develop an environmentally and agronomically superior soybean variety with low seed phytate.  Towards that aim, we now have developed two promising BC5 derived lines that are high yielding, determinate, and that continue to display high seed germination.  It also should be noted that both 56CX-1273 and 56CX-1283 were earlier in maturity than 5601T.
 
For 2013, we intend to test these two new lines, 56CX-1273 and 56CX-1283, in the Southern Uniform Quality Trait Test (MG V). The experiment will be planted in Stuttgart, AR, Kaiser, AR, Portageville, MO (clay), Portageville, MO (loam), Knoxville, TN, Blacksburg, VA and Warsaw, VA.  This past year in 2012, we conducted a yield trial in Knoxville, TN, and Milan, TN, for 10 of our most promising BC5 low phytate lines and data analyzed from this test showed that two of our low phytate lines, 56CX-1273 and 56CX-1283, yielded at 97% and 96%, respectively of 5601T, their recurrent parent and high yielding commercial cultivar. This is a noteworthy accomplishment, because experimental lines bred for the low phytate trait typically do not yield as high as lines bred directly for yield. An important goal of this project is to remedy the yield limitations of low phytate soybean, and we were encouraged by the yield performance of these two lines in our test. We now will be able to increase seeds for further tests of seed quality and performance.
 
 
North Carolina State University
 
Drought and salinity are the leading causes for crop loss around the globe. Calcium and other nutrients play important roles in plant response to drought and salinity. It was previously shown that constitutive expression of CBP, the calcium binding domain of the maize calreticulin gene, and AVP1, the Arabidopsis gene encoding H+-pyrophosphatase, each confers drought tolerance in transgenic Arabidopsis plants. We introduced 35S:CBP and AVP1 driven by the CaMV 35S promoter separately into cultivar Taipei 309 of rice, a model cereal crop plant, and then crossed them to see their effects on elemental homeostasis and the abiotic stress response. Confocal microscopy revealed that the CBP is predominantly located in ER. We used inductively coupled plasma (ICP)-emission spectrometry to quantify elemental composition and found that the total amount of calcium and phosphorous was higher in F1 progeny of the CBP x AVP1 cross compared to control plants. F1 progeny from CBP-, AVP1- and the cross of CBP x AVP1-transgenic plants all exhibited better drought tolerance than controls. Transgenic plants and F1 progeny from CBP x AVP1 transgenic rice plants showed higher leaf chlorophyll content and relative water content (RWC), and less wilting after intermittent drought treatment. Panicle seed yield was higher in transgenic plants and their F1. We also have tested our transgenic rice plants for salt tolerance and F1 progeny from CBP-, AVP1- and the cross of CBP x AVP1- transgenic plants all exhibited improved salt tolerance than control rice lines. They lost less chlorophyll after two different salt treatments and survived longer after the salt treatments. OsCIPK5 expression was nearly doubled in CBP transgenic plants, implicating a role of this protein in CBP-mediated drought and salt tolerance. The F1 plants performed similarly to the T1 transgenic plants in both tests and better than the control plants. However, no additive or synergistic effects were observed when both transgenes were in the same plants.
 
 
 
 
 
Virginia State University

This project was implemented at the Virginia State University from mid of 2010 to the end of 2012. Soybean lines, TN09-239 and USG5601T, were provided by Dr. Pantalone at University Tennessee and grown in VSU Randolph Farm in 2011 and 2012 in a randomized complete block design, with four row plots. Agronomic traits were recorded and compared between TN09-239 and USG5601T.

Both lines showed white flower and gray pubescence. In addition, they all have same flowering date and are resistant to shattering (score 1). TN09-239 and USG 5601T are all in maturity group 5 (MG V), however TN09-239 is in early MG V, while USG 5601T is in late MG V. In terms of 100 seeds weight, TN09-239 is little bit higher (22 g) than 5601T (21 g) but no significant difference. Although these two soybean lines were considered as near isogenic line with only difference at seedphytate level, we do find that the plant heights between TN09-239 and 5601T were significantly different with TN09-239 of 131.6 cm and 5601T of 68.0 cm. Because of this height difference, TN09-239 appeared more susceptible to lodging stress. This plant height difference may due to environmental difference. However, under this experimental design, we only include one location. Further evaluation at multi-locations on this issue is required to confirm this result. The yields of these two soybean lines showed no significant difference.

In addition to agronomic traits evaluated in the field, the harvested soybean seeds also were analyzed for protein concentration, oil concentration, fatty acid composition of the oil, and seed phosphorous contents. Total protein content in TN-239 seed is 42.06% on average, and in 5601T seed is 41.36% on average. No significant difference was observed. Total seeds oil content for TN239 is 18.45%, and 5601T is 18.59%. Again, no significant difference was observed.  Oil fatty acid composition results showed that TN-239 contains significant more 18:0 fatty acid (4.0%) than 5601T (3.6%). On the other hand, TN-239 has significantly less (6.95%) 18:3 fatty acids than that of 5601T (7.87%). All other oil fatty acid compositions showed no difference between these lines.

Total P content in seeds also was evaluated in two biologically duplicated samples. Results showed that TN-239 has significantly higher phosphate level (1.31g/kg seed) that 5601T (0.52g/kg seed). However, the phytate contents in the seeds are variable from repeat to repeat with the trend that TN-239 has less phytate than 5601T. More investigation is needed to make a solid conclusion on seed phytate content.

We also collected leaves from all plots and isolated DNA from each collected sample. SSR markers SATT237 and SATT561 were used to determine the phytate levels between TN09-239 and USG 5601T. Although the PCR products were successfully amplified from both varieties, separation on 4% agrose gel could not distinguish these two varieties. SNP markers were used to identify genotypes that control phytate levels. As expected, SNP markers used can distinguish these two lines at loci controlling phytate levels.

On the educational propose of this fellowship, the student, together with PIs were traveled to TN. The student was successfully trained on DNA technology, including different DNA isolation methods, SSR markers and SNP markers. Exposure to these state-of-the-art biotechnology facilities will give the student more understanding of the application of biotechnology to agriculture production and stimulate the student’s passion to pursue a biotechnology-related education and career. In fact, the first student who was recruitied has now graduated and has secured funding to continue her education at the graduate level. In addition, a second undergraduate student who was recruited to the project, will be well trained on soybean breeding related techniques upon completion of this project.

North Carolina A&T State University

Through Dr. Qu’s mentorship, we have not only learned how his group grows rice plants, but also trained our students through the project fellowship. Eight fellowships were awarded. This fellowship experience contributed greatly to our students’ experiential learning in plant biotechnology that is related to environment and agricultural sciences for successful careers in biotechnology- and/or environment-related fields. The project enabled fellows to gain more comprehensive knowledge than what is typically covered in traditional classroom lectures and laboratory sessions. Through active participation, they learned about project planning, experimental design and monitoring, data collection, and the impact of research on society.
 
This project also enabled North Carolina State University, a 1862 land-grant institution, and North Carolina A&T State University, a 1890 land-grant institution, to develop a meaningful collaboration.
 
For this reporting period, we continued our experiments to evaluate salt tolerance of the rice plants transgenic of the CBP or AVP1 gene provided by our mentor and collaborator, Dr. Qu from NCSU. Single-copy transgenic, homozygous T2 rice seeds were obtained from NCSU. The transgenic rice seedlings were grown at NC A&T greenhouse and were treated with various concentrations of NaCl solutions. Then the experiments were transferred to NCSU for better greenhouse growing conditions. Testing rice plants were evaluated for their growth (height, fresh and dry weight), and other physiological parameters such as chlorophyll content, Na+ and K+ contents and their ratio, and leaf relative water content. Detailed experiments are as follows:
·         Test species: one control and nine transgenic lines.
o    control - Wild Type (WT)
o    GFP
o    AVP 1-1
o    AVP 1-2
o    GFP-CBP-LOW
o    GFP-CBP-HIGH
o    GFP-CBP-LOW*AVP 1-1
o    GFP-CBP-LOW*AVP 1-2
o    GFP-CBP-HIGH*AVP 1-1
o    GFP-CBP-HIGH*AVP 1-2.
·         Treatment (NaCl, mM): control, 100, 200, and 300.
·         Replications: 4.
·         Data collected: (data were not analyzed yet, as the experiments are still on-going.)
o    Mineral content (Na and K)
o    Relative water content (RWC)
o    Electrolyte leakage
o    Proline
o    Chlorophyll (a, b and total)
o    Leaf and root fresh and dry weight
o    Plant height
o    Total protein.

University of Tennessee

The work in this year has been focused on exploring the mechanism of stress tolerance in transgenic plants over-expressing PtXTH22 gene and functional characterization of the PtXTH22 gene promoter.

In order to determine the mechanism for ABA tolerance of transgenic aspen plants, we analyzed the expression of stress-related genes, including ABI1 and 3, CBF1, ERD1, and bZIP28 involving ABA synthesis, freeze, drought, and heat stress tolerance, respectively, in Populus plants. The results indicated that expression of ABI1C, ABI3, ERD1, and bZIP28 genes was not markedly changed, and expression of CBF1 gene decreased in the line 18 compared with the wild type (Fig. 5). In the ABA-treated transgenic line 18, expression of the examined five genes was unchanged or changed in a very low level. In the transgenic line 2-A plants, expression of ABI1, ABI3, ERD1, and bZIP28 genes was not obviously changed, and expression of CBF1gene was roughly eight times lower than that in the wild type. In the ABA-treated transgenic line 2-A, expression of ERD1 and ABI1C genes was 16 to 32 times higher, and expression of ABI3 and bZIP28 gene was lower than that in the wild type. The figure also showed that expression of CBF1gene was up regulated, and expression of ABI3 gene was down regulated in response to exogenous ABA treatments in the line 18 and 2-A plants. However, fold changes of decreased expression of ABI3 were far higher than in line 2-A than in line 18 in response to 25 µM ABA treatment.
 
 
In ABA-treated conditions, a series of responses such as stomatal closure and stress-related gene expression would be generally induced in vegetative tissues. However, there were no obvious changes of expression of ABI1 and ABI3 genes in the ABA-treated or untreated transgenic line 18 and line 2-B compare with wild-type plants. It might indicate that endogenous ABA levels were not influenced by over or repressed expressions of PtXTH22; and 25 µM of ABA may be lower than the threshold value influencing gene expression in the transgenic line 18 with stronger ABA tolerance. In addition, expression of ERD1 gene, which was up-regulated in response to dehydration stress, was not affected by the ABA treatment, which further proved higher drought tolerance of the PtXTH22-overexpression transgenic plants. Expression of ABI1, ERD1, and ABI3 genes was greatly up-regulated and down-regulated in response to 25 µM ABA treatments, respectively. The results indicated that line 2-B transgenic plants were more sensitive in response to ABA treatment, which effected the expression of stressed-related genes. bZIP28, an essential component of a membrane-tethered transcription factor-bade signaling pathway that contributes to heat tolerance, was not influenced by over-expression and RNAi of PtXTH22 gene, or in response to ABA treatment, which probably implied function of PtXTH22 was not related to heat stress. CBF is the dehydration-responsive transcription factors. In our study, expression of CBF1 gene was greatly influenced by over-expression or RNAi of PtXTH22 gene, which probably means that expression of PtXTH22 gene was regulated via interaction CBF gene by an ABA dependent way.
 
To further determine the ABA and drought tolerant mechanism of PtXTH22 gene, model plant Arabidopsis (Col-0) was used as background and CaMV35-PtXTH22 construct was introduced into its genome. We have finished the transformation and got the transgenic Arabidopsis T2 plants over-expressing PtXTH22 gene. For ABA test, we are using both low concentration (0.5, 1, 2, 4 µM) and high concentration ABA (10, 20, 30, 40 µM) to treat transgenic Arabidopsis plantlets in tissue culture and spray transgenic plants in pots.  At the same time, we also are doing drought treatment, both 10% PEG 8000 simulating and real water-deficient test on our transgenic Arabidopsis plants. The results from transgenic Populus combined with those from Arabidopsis will give us a rather clear idea of the roles and how they work for PtXTH22 gene.
 
Binding elements in the PtXTH22 promoter region were analyzed and marked in order to analyze which sections of the promoter is responding to different stresses. Six GUS expressing constructs with different element deletion in PtXTH22 promoter region were used for transformation of Arabidopsis. The determination of which section in PtXTH22 promoter region respond to what stress is in process.
53TGACGTC (CREB) (-)
1      ACATCCTTTCCAAATTTATTTTTCAAAGAATTAATTTCAACTCATTAACG
TGACGT(ATF)53(-)    75 TATA BOX
51     TCAATGCACGAGATTCTTATATATGATCTCGAGAAAGATATTCGGTTAAC
                 118 TATAAA (TFIID) (-)
101    ATTACTCTCTTTTTTATACCTATCCTTCTCATGCGTGCGTGAAGCATAAT
151    TATGATCAACACAATCATTATTAATATAGTTATCCTGAACTTGGTATATA
223ATGCTAA (TRF) (-)
201    TTAAATTTTAAATCTATTAGCATGTCCAAGAGATCAGGAGCAGACTTCCA
 
251    AACAATATTCAATAAGATTTTTTTCTCCTCGGACAATCTATTAAGAAAAT
301    TCTTTCCTCTTGGCCAACCATTTCCACTATATATCACAGATATTTTAAGA
400 TATAAA (TFIID) (-)
351    ATAAATATTTGTGTATATATGGTATGCATGAGGAAAATATTTTTTTTATA
401    TTATTACGCAGTAGATAAAGCCCAGCTGGATGATCAATTCTTTATGAGAA
451    TTAAAATATTTTTGTGTGCTGTATCCTTTTTTATTACTGGCACAACAAAA
503 TGATTT (DBP) (-)   521 TATWAW (TFIID)
501    TCAAACGACAATATATATATATCAAGGGAAATTAATTATCTCAAATATGC
551    AAAATTTAAATTTGGCAACGTTTTTCTATTTTTTTTCAGCAATAATATTG
623 CTCTAAGC (HNF1) (+)
601    GAAAATTGTACTTTACTCTAAGCATGTAATTATTGTCGAAATCTTCATTT
651    TGGAGGGAAAGAAATAAATATGGTAGTAACATTAAATGTTGGAATATTTT
 
Iowa State University

The progress made toward each objective is described below:

  1. A series of bio-based resins have been investigated. Ring-opening metathesis polymerization (ROMP)-based copolymer of Dilulin (a modified linseed oil) and dicyclopentadiene (DCPD) and cationic-based copolymer of soybean oil, styrene and divinylbenzene have been selected as potential candidates for the pultrusion process. Resin formulations of these two systems were optimized to meet special requirements of pultrusion fabrication method, including rapid polymerization rate and thermomechanical properties of the cured resin. ROMP-based bioresins show promising high toughness, with a 3-fold improvement in toughness over the benchmark petroleum-based unsaturated polyester resin. Additional characterizations have been carried out to study the fracture toughness mechanism of the ROMP-based bioresin. To obtain best properties of fiberglass/ROMP-based bioresin composites, several silane coupling agents were applied to modify the glass fiber surface. Thermal and mechanical characterizations show that interfacial strength of the composite was improved significantly with norbornenylethyldimethylchlorosilane (MCS). This silane will also be applied in the pultrusion process to improve the properties of pultruded composites
  2. A table-top pultrusion system has been set up in our lab.We have successfully made prototype fiberglass samples with both commercial polyester and Dilulin/DCPD bioresin. Improvement of the pultrusion system to obtain high quality pultruded samples with a smooth outer surface is still in progress.
  3. Long term performance evaluations of ROMP-based Dilulin/DCPDresin and glass fiber composite have been carried out with QUV and XENON accelerated weathering test chambers.
In our initial work we investigated and optimized suitable bio-based resins for the pultrusion processing method. Among the variety of bioresins that have been developed at Iowa State overthe past 10 years, ROMP-based copolymer of modified linseed oil (Dilulin) and dicyclopentadiene (DCPD) is the first choice we want to develop in pultrusion processing. Because this resin system cures very fast with Grubbs’ catalyst, and the resulting polymer has good mechanical properties, it seems to be an ideal candidate for pultrusion processing. After evaluating several compositions, the optimized composition for this bio-based resin was selected at 30 wt% Dilulin and 70wt%DCPD (designated as Dil30DCPD70 for short). Another potential bio-based resin investigated for the pultrusion process is a copolymer of soybean oil, styrene and divinylbenzene (DVB), which is prepared from a cationic polymerization method. The optimized formulation is 50 wt% soybean oil, 25 wt% styrene and 23 wt% DVB, initiated with 2 wt% boron trifluoride (BFE). With the optimized composition, relatively good mechanical properties and suitable onset cure temperature were obtained. 
 
We noticed that Dilulin/DCPD bio-based resins were very tough, especially compared with commercially available thermosets, including the benchmark unsaturated polyester resins typically used in pultruded fiberglass composites. We have found that while the strength and stiffness of the bio-based Dil30DCPD70 ROMP polymers are lower than the polyester resin, the failure strain and toughness (area under the stress strain curve) are significantly higher than polyester as shown in Figure 2 below.
 
 
Further studies were carried out with Dilulin/DCPD resin system and glass fiber reinforced composites. Essential work of fracture and J-integral fracture testing was carried out to study the fracture toughness and the toughening mechanism of Dilulin/DCPD bioresins. Among a series of compositions of Dilulin/DCPD resins, Dil30DCPD70 shows the highest toughness. We hypothesize that the toughness property is closely related to crosslink density for these thermosets. On one hand, with high crosslink density, more covalent bonds break on the fracture surface, absorbing more energy. On the other hand, high crosslink density usually results in lower shear yielding via network stretching and lower energy absorption in this step. So 30 wt% Dilulin and 70 wt% DCPD is the optimized composition that shows the highest toughness. The promising toughness property of Dil30DCPD70 may bring some potential applications for this bioresin, such as energy absorbing structures and impact resistance.
 
We also have been working on improving the interfacial adhesion of glass fiber reinforced Dil30DCPD70 bio-based resin with various silane coupling agents. Previous study of this composite system showed that poor interface exists, which usually results in lower mechanical properties. Our purpose is to improve the interfacial adhesion between the glass fiber and the bio-based resin matrix. Two types of silanes were applied, norbornenylethyldimethylchlorosilane (MCS) and norbornenylethyltrichlorosilane (TCS). Interfacial adhesion was evaluated by microbond pull-out technique, which showed improvement in the interfacial shear strength (IFSS) with both silanes. IFSS increased ~150% with MCS and IFSS increased ~50% with MCS, compared with as-received glass fiber (see Figure 3 below). Dynamic mechanical analysis (DMA) studies of silane-treated fiberglass/Dil30DCPD70 laminates showed increased storage modulus and glass transition temperature with both types of composites, especially the one containing MCS-treated fiber. Studies indicate that MCS works better than TCS on improving the interfacial adhesion in composites. So in the future, MCS will be applied to glass fiber in the pultrusion process to improve the mechanical properties of the pultruded composite.
 
 
We also have been evaluating the short and long term performance of Dil30DCPD70 bio-based resin under different conditions. Samples were treated in an accelerated weathering chamber at Pella Corporation with UV radiation (see Figure 4), full-spectrum sunlight and severe hot-wet-cold circular weathering exposure. Tensile test resultsof UV-treated samples show that tensile strength and Young’s modulus didn’t change within 1000 h UV treatment, and then decreased slightly with longer exposure time. However, break strain and tensile toughness decreased significantly due to the formation of surface cracks under even short time exposure. Similar results also show in full-spectrum sunlight exposure samples and hot-wet-cold circular exposure samples. Soxhlet extraction results indicate that crosslink density of the bioresin was enhanced a little after UV treatment. Photoacoustic spectroscopy and SEM both demonstrate that degradation is a surface effect. About a 100 µm thick degradation layer was observed on the sample exposed to the most severe condition in our experiment, 2000 h UV radiation.  Because the ROMP-based polymers contain many residual carbon-carbon double bonds (C=C bonds are not consumed in ROMP), we anticipate better environmental stability in the cationic polymerized bio-based resins (in which the C=C bonds are consumed during the cationic polymerization), which will be evaluated in Year 2.
 
 
A final area we have been working on is setting up a table-top pultrusion machine in our lab to estimate processing conditions for fiberglass/bioresin system (shown in Figure 5). The table-top pultrusion contains roller guide, resin bath, die, heat plates and puller. The die is 600 mm long with a rectangular profile of 25mm x 2mm. The die also was designed with water circulation system for controlling temperature in different heating zones. During processing, the die was divided into three heating zones, two relatively low temperature heating zones on both ends and one high temperature heating zone in the middle. We have made composites using both commercial polyester and the ROMP-based bioresin (Dil30DCPD70) (see Figure 6). We have overcome one of significant problems, sticking, with coating the inner surface of die with Teflon tape. Another significant problem we dealt with is increasing the pulling force of the nip roller puller by using a more powerful motor and designing a suitable gear train. The resulting pultruded fiberglass/Dil30DCPD70 composite is stiff, but results in composites with scratches on the surface. Release agent is being considered to improve the surface finish and processability for next step. Further optimizing of processing parameters is still under way.
 
 

 

Future Activities:

University of Tennessee

Now that we have the determinate linkage resolved, we can increase seed and follow up on testing for yield and nutrition for the trait.

North Carolina State University

The project is completed.

North Carolina A&T State University

Analyzing data, and preparing abstracts and manuscripts for presentations and/or publications.

University of Tennessee

  1. Determinethe mechanism for drought and ABA tolerance of transgenic plants.
  2. Test the transgenic soybean for drought tolerance.
  3. Further test the pXTH22:GUS transgenic Arabidopsis to determine whether the promoter is multi-stress inducible.
  4. Test different sections of promoter to determine which sections of promoter is responding different stresses.

Iowa State University

In the upcoming year, we plan to (1) continue to improve the process ability and appearance quality of pultruded fiberglass/Dil30DCPD70 composites with our table-top pultrusion machine; (2) evaluate short and long term strength and durability of the pultruded fiberglass/Dil30DCPD70 composites; (3) apply silane coupling agent in fiberglass/Dil30DCPD70 system to further improve the properties of the pultruded composites; and (4) apply the cationic polymerization resin system in thepultrusion process.

More specifically, we have carried out many trials with the ROMP-based Dil30DCPD70 bioresin system on our table-top pultrusion machine. The resulting pultruded composites have a rough surface, effecting the appearance of the composite material. This surface roughness is believed to be caused by a stick-slip progression during processing. Our plans for the coming year are to continue optimizing the processing parameters and to find the best combination of pulling rate, cure temperature and fiber ratio to produce pultruded composites with perfect profile shape and smooth surface. At the same time, we also will add some release agents into the resin. There are a wide range of commercially available release agents in the market. Finding the most suitable type and additive amount of the release agent, as well as the effect of release agents on final pultruded products also will be a part of our future work.

Once we can get good samples from repeatable trials, we will start to characterize the properties of the pultruded composites and compare them to the existing unsaturated polyester pultruded materials. A series of engineering properties that are necessary for structural materials will be evaluated following ASTM standards, such as tensile strength, Young’s modulus, flexure strength, flexure modulus, coefficient of thermal expansion, impact behavior, and compressive properties. The long-term performance of the bio-based pultruded composites will be evaluated with the help of our industrial partner and their extensive environmental chemistry and product test laboratories. Materials will be subjected to a range of elevated temperature and environmental conditions, including humidity, ultraviolet radiation, and full-spectrum sunlight. The effects of those conditions on discoloration, swelling, warping, delaminating, and change in mechanical properties will be analyzed systematically. Because we already studied the long-term performance of the neat resin in the first year of the study, these results will be helpful to gain an understanding of the effect of reinforcement on the long-term performance of pultruded composites.

In the first year of the project, we have investigated the effect of using silane coupling agents on improving the compatibility and adhesive strength between the glass fibers and the bio-based resin. Our studies indicate that interfacial strength between glass fiber and Dil30DCPD70 bio-matrix is increased significantly with the application of norbornenylethyldimethylchlorosilane coupling agent. So applying this silane in the pultrusion process will further enhance properties of the final pultruded composites. The challenge is developing a process for applying the silane in a continuous pultrurion process. Usually, in industry, silane coupling agent can be applied in a solution or in vapor phase. We will compare these two methods first in batch processed conditions that involve treating the glass fiber with silane solution or silane vapor prior to the pultrusion process. Then we will try to add the silane coupling agent during the pultrusion process. Special equipment will be designed to fit the whole continuous pultrusion process. Taking the silane solution method for example, a silane solution bath and a drying tube furnace will be implemented before resin bath in the pultrusion process line.

Our efforts in the second year also will be focused on the cationic polymerization resin system - soybean oil, styrene and divinylbenzeneapplied to the pultrusion process. Following similar experiments as used for the ROMP-based bioresin, processing parameters and a suitable release agent will be optimized first. One challenge for cationic-based bioresin is stabilization of the resin after mixing with initiator. It is difficult for this resin to remain stable at room temperature after it has been mixed with the cationic initiator, especially in large amounts where cure exothermic conditions can increase the temperature of the resin bath. Lowering the resin storage temperature is one approach to increasing pot life of the resin. Towards this end, a special resin bath will be designed for the cationic resin system. Once we can get good samples from pultrution, short-term and long-term performance will be evaluated and also compared with unsaturated polyester materials and the ROMP resin system. 

University of Georgia

Paired-end sequencing of about 120,000 BACs – this has been completedIndeed, while our proposal was under consideration by CPBR, another (public) entity supported end-sequencing of about 60,000 BACs from the G. raimondii HindIII library.  Accordingly, the PI and representatives of the matching company (Bayer) agreed to an accordingly reduced investment in BAC end sequencing (that has been met through a contract with a third party, the Hudson Alpha Institute) … redirecting the remaining resources to reduced-representation resequencing of about 30 cotton genotypes, about 14 of which are selected by Bayer for proprietary reasons. The remainder will be selected from publicly available germplasm by the PI but in consideration of feedback from Bayer, giving preference to genotypes from which there exist other publicly available resources (for example Pima S6 and Acala Maxxa have BAC libraries, and G. barbadense K101 was used in reference genetic mapping), and/or which are parents of populations that are being made toward a cotton nested association mapping (NAM) resource.  Several of the public lines have been tentatively completed, although data validation remains pending.  Bayer is preparing DNA of its lines for shipment to the PI. 

Computational analysis of the resulting sequence assembly by several tests to identify possible errors, conducted in the PI’s lab as described (Paterson, et al., 2009), including:

  1. Comparison to the order of sequence-tagged-sites along the (~1 cM density) cotton genetic map (Rong, et al., 2004), to investigate accuracy across regions of several cM or more.
  2. Comparison to the order of overgo and BAC-end sequences in BAC clones comprising the physical map (detailed above), testing contiguity of regions of less than the ~1 cM resolution of the genetic map, down to the ~100 kb average size of a BAC,
  3. Comparison to the Arabidopsis genome, the most complete angiosperm genome and the closest relative of cotton that has been fully sequenced.  We have previously shown appreciable microsynteny and even some regions of macrosynteny between Arabidopsis and cotton (Rong, et al., 2005a). A sequence scaffold would not be expected to show long stretches of cotton-Arabidopsis synteny if incorrectly assembled. However, because there will surely be many (hundreds?) small rearrangements between these taxa, synteny information will be used only to support other lines of evidence, and the assembly will never exclusively rely on synteny to support any genome arrangement.

Items a and b, above, were completed in advance of public release (under Ft Lauderdale principles) of the genome assembly in January 2012. 

Item c was completed as an element of the primary description of the cotton reference genome sequence (Paterson, et al., 2012), confirming early results supportive of the high quality of assembly, and revealing an unexpected dimension of cotton genome evolution, specifically that it has experienced a paleopolyploidy of complexity previously unprecedented … it remains unclear whether this resulted in an aggregate 5x or 6x increase of cotton chromosome numbers, and whether it was a single event or two very closely spaced events (for example 3x followed by 2x).

References:

Febvay, G., B. Delobel & Y. Rahbe (1988) Influence of the amino-acid balance on the improvement of an artificial diet for a biotype of Acyrthosiphon-pisum (Homoptera, Aphididae). Canadian Journal of Zoology-Revue Canadienne De Zoologie, 66, 2449-2453.

Li, J., Koni, P. A. and Ellar, D. J. (1996). Structure of the mosquitocidal delta-endotoxin CytB from Bacillus thuringiensis sp. kyushuensis and implications for membrane pore formation. J. Mol. Biol. 257, 129-152.

Liu, S., Sivakumar, S., Sparks, W.O., Miller, W.A., Bonning, B.C. (2010). A peptide that binds the pea aphid gut impedes entry of Pea enation mosaic virus into the aphid hemocoel. Virology 401 (1): 107-16.

Pérez C., Fernandez L.E., Sun J., Folch J.L., Gill S.S., Soberón M. (2005). Bacillus thuringiensis subsp. israelensis Cyt1Aa synergizes Cry11Aa toxin by functioning as a membrane-bound receptor. PNAS, vol. 102 no. 51 18303-18308.


Journal Articles: 6 Displayed | Download in RIS Format

Other center views: All 21 publications 7 publications in selected types All 6 journal articles
Type Citation Sub Project Document Sources
Journal Article Chougule NP, Li H, Liu S, Linz LB, Narva KE, Meade T, Bonning BC. Retargeting of the Bacillus thuringiensis toxin Cyt2Aa against hemipteran insect pests. Proceedings of the National Academy of Sciences of the United States of America 2013;110(21):8465-8470. EM834388 (2012)
  • Full-text from PubMed
  • Abstract from PubMed
  • Associated PubMed link
  • Full-text: PNAS-Full Text HTML
    Exit
  • Abstract: PNAS-Abstract
    Exit
  • Other: PNAS-Full Text PDF
    Exit
  • Journal Article Cui H, Kessler MR. Glass fiber reinforced ROMP-based bio-renewable polymers: enhancement of the interface with silane coupling agents. Composites Science and Technology 2012;72(11):1264-1272. EM834388 (2012)
  • Abstract: ScienceDirect-Abstract
    Exit
  • Other: ResearchGate-Abstract
    Exit
  • Journal Article Madbouly SA, Xia Y, Kessler MR. Rheokinetics of ring-opening metathesis polymerization of bio-based castor oil thermoset. Macromolecules 2012;45(19):7729-7739. EM834388 (2012)
  • Abstract: ACS-Abstract
    Exit
  • Journal Article Paterson AH, Wendel JF, Gundlach H, Guo H, Jenkins J, Jin D, Llewellyn D, Showmaker KC, Shu S, Udall J, Yoo MJ, Byers R, Chen W, Doron-Faigenboim A, Duke MV, Gong L, Grimwood J, Grover C, Grupp K, Hu G, Lee TH, Li J, Lin L, Liu T, Marler BS, Page JT, Roberts AW, Romanel E, Sanders WS, Szadkowski E, Tan X, Tang H, Xu C, Wang J, Wang Z, Zhang D, Zhang L, Ashrafi H, Bedon F, Bowers JE, Brubaker CL, Chee PW, Das S, Gingle AR, Haigler CH, Harker D, Hoffmann LV, Hovav R, Jones DC, Lemke C, Mansoor S, ur Rahman M, Rainville LN, Rambani A, Reddy UK, Rong JK, Saranga Y, Scheffler BE, Scheffler JA, Stelly DM, Triplett BA, Van Deynze A, Vaslin MF, Waghmare VN, Walford SA, Wright RJ, Zaki EA, Zhang T, Dennis ES, Mayer KF, Peterson DG, Rokhsar DS, Wang X, Schmutz J. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres. Nature 2012;492(7429):423-427. EM834388 (2012)
  • Abstract from PubMed
  • Full-text: Nature-Full Text PDF
    Exit
  • Abstract: Nature-Abstract & Full Text HTML
    Exit
  • Other: ResearchGate-Abstract & Full Text PDF
    Exit
  • Journal Article Thunga M, Xia Y, Gohs U, Heinrich G, Larock RC, Kessler MR. Influence of electron beam irradiation on the mechanical properties of vegetable-oil-based biopolymers. Macromolecular Materials and Engineering 2012;297(8):799-806. EM834388 (2012)
  • Abstract: Wiley-Abstract
    Exit
  • Journal Article Ye X, Yuan S, Guo H, Chen F, Tuskan GA, Cheng Z-M. Evolution and divergence in the coding and promoter regions of the Populus gene family encoding xyloglucan endotransglycosylase/hydrolases. Tree Genetics & Genomes 2012;8(1):177-194. EM834388 (2012)
  • Full-text: Bioenergy Center-Full Text PDF
    Exit
  • Abstract: Springer-Abstract
    Exit
  • Other: ResearchGate-Abstract
    Exit
  • Supplemental Keywords:

    Bt toxin; aphid control, phytic acid, phosphorous nutrient load, eutrophication, clean water, calcium, chlorophyll, CIPK, RWC, salt, marker-assisted selection; low phytate soybean; molecular breeding, agronomic traits, chlorophyll, electrolyte leakage, proline, protein, relative water content, stress tolerance, sustainability, bio-based, polymers, composites, agricultural oils, pultrusion, somatic embryogenesis, redox chemicals, oxidation, reduction

    Relevant Websites:

    Iowa State University's Polymer Composites Research Group Exit
    Vegetable Oil-based Polymeric Materials Exit
    Pultruded Bio-composites Exit
    Biopolymers & Biocomposites Research Team (BBRT) Exit
    Cotton Incorporated Exit
    Plant Genome Mapping Laboratory Exit

    Progress and Final Reports:

    Original Abstract
  • 2009
  • 2010
  • 2011 Progress Report
  • Final