2006 Progress Report: Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins

EPA Grant Number: R829479C021
Subproject: this is subproject number 021 , established and managed by the Center Director under grant R829479
(EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).

Center: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program
Center Director: Schumacher, Dorin
Title: Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins
Investigators: Cheng, Zong-Ming
Institution: University of Tennessee - Knoxville
EPA Project Officer: Lasat, Mitch
Project Period: October 1, 2004 through September 30, 2007 (Extended to December 31, 2007)
Project Period Covered by this Report: October 1, 2005 through September 30, 2006
RFA: The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program (2001) RFA Text |  Recipients Lists
Research Category: Hazardous Waste/Remediation , Targeted Research

Objective:

The objectives are:

  1. To construct the transformation vectors with the already cloned metallohistin cDNA agNt84 under control by constitutive promoter CaMV35S.
  2. To transfer the genes into a woody plant, a Populus hybrid, and annual plants, Brassica napus and B. juncea, and to confirm transformation by polymerase chain reaction and Southern blot.
  3. To determine levels of RNA and protein expression in different tissues.
  4. To characterize the transgenic plants for their metal accumulation capacity and phytoremediation potential.
  5. To determine the short- and long -term effects of the overexpression of metallohistin on growth and development of the transgenic plants.

Progress Summary:

Cloning of AgNt84 in a Binary Vector Under the Control of CaMV35S Promoter

AgNt84 was PCR amplified from the initial cDNA clone using forward 5’CAGCGGATCCCATTGTCTCCAATCCTCTTCA3’ and reverse primer 5’TGACGAGCTCAGACGTACGTACAACTGATAGCAT3’, which introduced BamHI and SacI sites, respectively. The BamHI-SacI fragment was then ligated into pBI121, in front of a CaMV35S promoter as shown in Figure 1.

pBINAgNt84: Binary Vector Used for Transformation

Figure 1. pBINAgNt84: Binary Vector Used for Transformation

Plant Transformation

The vector was introduced into Agrobacterium tumefaciens strain GV3850, and Populus and Brassica plant transformation was initiated. Because Populus and Brassica transformation is slower, we proceeded to transform tobacco and Arabidopsis in order to evaluate the construct. Arabidopsis thaliana ecotype Col1 plants were transformed by the floral dip method and Nicotiana tabacum cv. Xanthi were transformed by the leaf disc transformation method.

The gene was later transformed into Populus tree. We have obtained 80 kanamycin-resistant hybrid aspen plants (Figure 2). Leaves collected from about 2-month- old transgenic plants, grown in the culture room, were confirmed by PCR (Figure 3). Currently, 18 putatively transformed plants have been confirmed by PCR. An additional 60 -80 plants will be confirmed by PCR. Southern blots will be performed to determine the copy numbers. For the confirmed aspen lines, each line has approximately 2 -6 copies. We will multiply each line to about 10 plants for heavy metal test for phytoremediation.

Kanamycin-Resistant Poplar Plants and PCR Confirmation.

Figure 2. Kanamycin-Resistant Poplar Plants                  Figure 3. PCR Confirmation                         

Transgenic Brassica jancea has also been obtained. Confirmation has also been done with PCR.

Transgenic Plants Express AgNt84 and Appear Normal

Expression of AgNt84 was confirmed by northern blot (Figure 4). The protein, however, was in an unextractable form, tightly bound to the cell wall. Immunostaining of cell wall pellets showed a strong fluorescent signal from transgenic plants compared to controls (Figure 5). Overall, transgenic plants appeared normal, indicating that overexpression of a metallohistin gene did not interfere with normal plant cell metabolism.

Northern Blot of Transgenic Arabidopsis Lines.

Figure 4. Northern Blot of Transgenic Arabidopsis Lines. Ten μ g total RNA was run and probed with the AgNt84 cDNA clone. Bottom panel is 18S RNA shown for equal loading.

Immunostaining of Pellets From Cell Wall Protein Extraction Show That AgNt84 is Still Tightly Bound Within the Cell Wall.

Figure 5. Immunostaining of Pellets From Cell Wall Protein Extraction Show That AgNt84 is Still Tightly Bound Within the Cell Wall. Immunostaining was performed with rabbit preimmune and anti-AgNt84 immune serum, followed by incubation with FITC-linked Goat Anti-rabbit IgG as the secondary antibody.

Transgenic Plants Accumulate More Cadmium

Preliminary experiments were conducted to assess the metal binding ability of transgenic plants by a dithiazone staining method. Tobacco plants hydroponically grown in 5 mM MES buffer without Cd showed no staining characteristic of Cd accumulation. When grown on buffer containing 200 mM Cd(NO3)2, staining was observed starting from day 1 in root tissue (Figure 6).

Metal Binding in Transgenic Tobacco: Dithizone Staining of Tobacco Wild-Type (WT) and Transgenic Lines T12 and T17 Hydroponically Grown in the Presence or Absence of 200 mM Cd (NO3)2

Figure 6. Metal Binding in Transgenic Tobacco: Dithizone Staining of Tobacco Wild-Type (WT) and Transgenic Lines T12 and T17 Hydroponically Grown in the
Presence or Absence of 200 mM Cd (NO3)2. Arrows indicate staining resulting from the formation of Cd dithizonate. The color of dithizonate ranges from
an orange red to red-violet color in order of increasing Cd concentration in the tissue. Intense staining is observed with transgenic plants compared to WT.

Future Activities:

The project is progressing according to schedule. Additional B. jancea will be produced and confirmed. Transgenic poplar plants will be confirmed with Southern blots to determine the copy number and will be determined for actual gene expression by northern blot. Year 2 will focus on the metal binding in both poplar and B. jancea to determine the plant growth under heavy metal stress

Journal Articles:

No journal articles submitted with this report: View all 1 publications for this subproject

Supplemental Keywords:

genetic engineering, heavy metal contamination, phytoremediation,, Scientific Discipline, Waste, TREATMENT/CONTROL, POLLUTANTS/TOXICS, Treatment Technologies, Chemicals, Technology, Biochemistry, Bioremediation, Molecular Biology/Genetics, Biology, plant-based remediation, metallohistins, transgenic plants, plant uptake studies, biotechnology, plant biotechnology, phytoremediation

Progress and Final Reports:

Original Abstract
  • 2005 Progress Report
  • 2007
  • Final

  • Main Center Abstract and Reports:

    R829479    The Consortium for Plant Biotechnology Research, Inc., Environmental Research and Technology Transfer Program

    Subprojects under this Center: (EPA does not fund or establish subprojects; EPA awards and manages the overall grant for this center).
    R829479C001 Plant Genes and Agrobacterium T-DNA Integration
    R829479C002 Designing Promoters for Precision Targeting of Gene Expression
    R829479C003 aka R829479C011 Biological Effects of Epoxy Fatty Acids
    R829479C004 Negative Sense Viral Vectors for Improved Expression of Foreign Genes in Insects and Plants
    R829479C005 Development of Novel Plastics From Agricultural Oils
    R829479C006 Conversion of Paper Sludge to Ethanol
    R829479C007 Enhanced Production of Biodegradable Plastics in Plants
    R829479C008 Engineering Design of Stable Immobilized Enzymes for the Hydrolysis and Transesterification of Triglycerides
    R829479C009 Discovery and Evaluation of SNP Variation in Resistance-Gene Analogs and Other Candidate Genes in Cotton
    R829479C010 Woody Biomass Crops for Bioremediating Hydrocarbons and Metals
    R829479C011 Biological Effects of Epoxy Fatty Acids
    R829479C012 High Strength Degradable Plastics From Starch and Poly(lactic acid)
    R829479C013 Development of Herbicide-Tolerant Energy and Biomass Crops
    R829479C014 Identification of Receptors of Bacillus Thuringiensis Toxins in Midguts of the European Corn Borer
    R829479C015 Coordinated Expression of Multiple Anti-Pest Proteins
    R829479C016 A Novel Fermentation Process for Butyric Acid and Butanol Production from Plant Biomass
    R829479C017 Molecular Improvement of an Environmentally Friendly Turfgrass
    R829479C018 Woody Biomass Crops for Bioremediating Hydrocarbons and Metals. II.
    R829479C019 Transgenic Plants for Bioremediation of Atrazine and Related Herbicides
    R829479C020 Root Exudate Biostimulation for Polyaromatic Hydrocarbon Phytoremediation
    R829479C021 Phytoremediation of Heavy Metal Contamination by Metallohistins, a New Class of Plant Metal-Binding Proteins
    R829479C022 Development of Herbicide-Tolerant Energy and Biomass Crops
    R829479C023 A Novel Fermentation Process for Butyric Acid and Butanol Production from Plant Biomass
    R829479C024 Development of Vectors for the Stoichiometric Accumulation of Multiple Proteins in Transgenic Crops
    R829479C025 Chemical Induction of Disease Resistance in Trees
    R829479C026 Development of Herbicide-Tolerant Hardwoods
    R829479C027 Environmentally Superior Soybean Genome Development
    R829479C028 Development of Efficient Methods for the Genetic Transformation of Willow and Cottonwood for Increased Remediation of Pollutants
    R829479C029 Development of Tightly Regulated Ecdysone Receptor-Based Gene Switches for Use in Agriculture
    R829479C030 Engineered Plant Virus Proteins for Biotechnology